Incidental Mutation 'R0494:Rnf213'
ID 42682
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 038691-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 119393100-119487418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119443120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 3052 (M3052L)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000093902
AA Change: M3053L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: M3053L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: M3052L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: M3052L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.2269 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,420,723 (GRCm38) probably null Het
Aatf T C 11: 84,511,513 (GRCm38) I116V probably benign Het
Abhd18 T C 3: 40,916,688 (GRCm38) F94S probably damaging Het
Adam28 T A 14: 68,630,792 (GRCm38) probably benign Het
Amn1 A T 6: 149,185,136 (GRCm38) probably benign Het
Arhgap32 T C 9: 32,258,903 (GRCm38) V993A probably damaging Het
Arhgap33 A T 7: 30,524,496 (GRCm38) S703T probably damaging Het
Arhgef1 T C 7: 24,919,360 (GRCm38) probably benign Het
Atg2a A G 19: 6,253,377 (GRCm38) Y1083C probably damaging Het
Atp2a3 T C 11: 72,981,905 (GRCm38) F760L probably damaging Het
B9d1 A G 11: 61,512,445 (GRCm38) probably benign Het
Batf C T 12: 85,686,862 (GRCm38) probably benign Het
BC051019 T A 7: 109,717,975 (GRCm38) Y170F probably benign Het
Bphl T C 13: 34,037,771 (GRCm38) *37Q probably null Het
Cab39l T C 14: 59,499,559 (GRCm38) S43P probably damaging Het
Cad A G 5: 31,077,512 (GRCm38) probably benign Het
Cct4 T G 11: 22,996,014 (GRCm38) S119A probably benign Het
Cd163 G A 6: 124,311,449 (GRCm38) V280M probably damaging Het
Cd86 A G 16: 36,618,637 (GRCm38) probably benign Het
Cdh23 G A 10: 60,316,596 (GRCm38) probably benign Het
Cdhr5 A G 7: 141,272,518 (GRCm38) F145S probably damaging Het
Cdt1 T C 8: 122,572,060 (GRCm38) S479P possibly damaging Het
Ces2g T C 8: 104,966,567 (GRCm38) V372A probably benign Het
Chrna3 T C 9: 55,022,278 (GRCm38) D92G probably damaging Het
Cndp1 A G 18: 84,619,533 (GRCm38) S359P probably benign Het
Cops4 A G 5: 100,528,662 (GRCm38) Q93R probably damaging Het
Dgka G C 10: 128,721,083 (GRCm38) probably benign Het
Dmp1 A T 5: 104,212,208 (GRCm38) D250V probably damaging Het
Dnajb2 C T 1: 75,239,634 (GRCm38) probably benign Het
Dock9 T C 14: 121,662,584 (GRCm38) T113A possibly damaging Het
Egln3 T A 12: 54,203,321 (GRCm38) I81F probably benign Het
Elovl5 T C 9: 77,960,917 (GRCm38) V37A probably benign Het
Esco1 A T 18: 10,594,940 (GRCm38) N115K probably benign Het
Fat1 A T 8: 44,950,542 (GRCm38) N110I probably damaging Het
Fezf1 T A 6: 23,246,055 (GRCm38) K370N probably damaging Het
Galnt18 T A 7: 111,554,564 (GRCm38) K284N probably damaging Het
Glt8d1 C A 14: 31,011,623 (GRCm38) T355K possibly damaging Het
Gm13083 G T 4: 143,616,156 (GRCm38) V278F probably benign Het
Gm17455 G A 10: 60,403,235 (GRCm38) R93H possibly damaging Het
Gng8 T A 7: 16,895,288 (GRCm38) D46E probably benign Het
Gpx4 T C 10: 80,056,177 (GRCm38) probably benign Het
Grk2 A T 19: 4,291,319 (GRCm38) N189K probably damaging Het
Grm5 T C 7: 88,130,781 (GRCm38) V1143A probably benign Het
Hibch A G 1: 52,902,896 (GRCm38) E237G possibly damaging Het
Hipk2 C T 6: 38,729,989 (GRCm38) A682T probably benign Het
Hmcn1 G T 1: 150,732,792 (GRCm38) probably benign Het
Htt A G 5: 34,821,844 (GRCm38) D857G possibly damaging Het
Idh2 C T 7: 80,098,257 (GRCm38) A232T probably damaging Het
Igsf8 A G 1: 172,318,698 (GRCm38) E421G probably benign Het
Kif26a T A 12: 112,179,471 (GRCm38) probably null Het
Klhl26 T C 8: 70,451,601 (GRCm38) Y519C probably damaging Het
Lamc1 A C 1: 153,246,936 (GRCm38) probably null Het
Mical3 A T 6: 120,959,201 (GRCm38) S1455T possibly damaging Het
Mitf G A 6: 97,994,429 (GRCm38) G186S probably benign Het
Ms4a15 G A 19: 10,981,358 (GRCm38) probably benign Het
Myo5b A G 18: 74,653,967 (GRCm38) E481G probably damaging Het
Nanos3 C T 8: 84,176,134 (GRCm38) R133Q probably damaging Het
Nbeal2 C A 9: 110,627,187 (GRCm38) V1686L probably damaging Het
Nedd4l T G 18: 65,173,021 (GRCm38) S335A possibly damaging Het
Nos1 A T 5: 117,905,474 (GRCm38) N605Y probably damaging Het
Nyx C A X: 13,487,269 (GRCm38) T454K probably benign Het
Olfr666 A G 7: 104,893,271 (GRCm38) L119P probably damaging Het
Olfr972 T A 9: 39,873,402 (GRCm38) N42K probably damaging Het
Pcdhb12 T A 18: 37,438,095 (GRCm38) F765I probably benign Het
Pex3 C T 10: 13,527,788 (GRCm38) G330R probably damaging Het
Pfkfb1 T C X: 150,634,613 (GRCm38) Y339H probably damaging Het
Pias1 G A 9: 62,887,311 (GRCm38) Q26* probably null Het
Pik3cg C A 12: 32,204,546 (GRCm38) V481L possibly damaging Het
Plcg2 C T 8: 117,556,104 (GRCm38) T108M probably damaging Het
Pon2 G A 6: 5,267,059 (GRCm38) probably benign Het
Ppef2 A T 5: 92,253,093 (GRCm38) probably benign Het
Ptpn22 A G 3: 103,860,455 (GRCm38) K18E probably damaging Het
Pum2 C T 12: 8,721,736 (GRCm38) Q360* probably null Het
Rab10 A C 12: 3,252,723 (GRCm38) probably null Het
Ranbp2 T G 10: 58,467,432 (GRCm38) S809A possibly damaging Het
Rbms2 A G 10: 128,133,670 (GRCm38) V348A probably benign Het
Rpl14 C A 9: 120,574,362 (GRCm38) probably benign Het
Rplp0 A G 5: 115,559,872 (GRCm38) Y13C possibly damaging Het
Ryr1 A G 7: 29,003,793 (GRCm38) probably benign Het
Sac3d1 T C 19: 6,118,294 (GRCm38) E98G probably damaging Het
Scn10a T A 9: 119,624,100 (GRCm38) D1242V probably damaging Het
Scnn1b T C 7: 121,899,458 (GRCm38) Y74H probably damaging Het
Serpinb3a C T 1: 107,047,482 (GRCm38) W198* probably null Het
Sf3b4 C A 3: 96,173,701 (GRCm38) D108E probably damaging Het
Shprh T C 10: 11,157,191 (GRCm38) V307A probably damaging Het
Slc2a2 A G 3: 28,727,277 (GRCm38) D458G probably benign Het
Spata5 G C 3: 37,432,163 (GRCm38) D345H possibly damaging Het
Strc T C 2: 121,379,533 (GRCm38) D103G probably damaging Het
Synrg T C 11: 84,019,543 (GRCm38) I923T probably benign Het
Tango6 G T 8: 106,735,682 (GRCm38) probably benign Het
Tas2r106 A G 6: 131,678,576 (GRCm38) L104P probably damaging Het
Tat C T 8: 109,991,684 (GRCm38) P67L probably damaging Het
Tln2 A C 9: 67,355,197 (GRCm38) S593A probably benign Het
Tmem94 A G 11: 115,794,781 (GRCm38) probably null Het
Tppp3 G A 8: 105,468,172 (GRCm38) A109V probably benign Het
Trank1 T C 9: 111,391,293 (GRCm38) F2366S probably benign Het
Trpc5 T A X: 144,481,396 (GRCm38) Y155F probably damaging Het
Trpv1 A G 11: 73,260,442 (GRCm38) T451A probably benign Het
Ttc9 C A 12: 81,631,649 (GRCm38) A82E probably damaging Het
Ttll11 T A 2: 35,944,874 (GRCm38) N180I probably damaging Het
Ttn T C 2: 76,736,399 (GRCm38) N28050S possibly damaging Het
Vmn2r73 G T 7: 85,872,932 (GRCm38) H66Q probably benign Het
Vmn2r92 C T 17: 18,167,957 (GRCm38) A408V probably damaging Het
Wnt3 G A 11: 103,812,315 (GRCm38) C208Y probably damaging Het
Zfp521 C A 18: 13,845,268 (GRCm38) C696F probably damaging Het
Zfp521 T C 18: 13,846,870 (GRCm38) D162G probably damaging Het
Zfp869 A T 8: 69,706,404 (GRCm38) H506Q probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,449,343 (GRCm38) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,440,843 (GRCm38) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,447,237 (GRCm38) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,483,118 (GRCm38) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,443,300 (GRCm38) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,449,876 (GRCm38) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,436,352 (GRCm38) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,441,307 (GRCm38) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,442,266 (GRCm38) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,443,015 (GRCm38) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,416,457 (GRCm38) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,443,268 (GRCm38) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,418,309 (GRCm38) splice site probably benign
IGL02084:Rnf213 APN 11 119,445,673 (GRCm38) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,440,650 (GRCm38) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,480,907 (GRCm38) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,463,336 (GRCm38) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,436,802 (GRCm38) missense probably benign
IGL02588:Rnf213 APN 11 119,416,536 (GRCm38) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,440,789 (GRCm38) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,435,066 (GRCm38) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,427,510 (GRCm38) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,479,941 (GRCm38) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,445,626 (GRCm38) splice site probably benign
IGL03057:Rnf213 APN 11 119,441,087 (GRCm38) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,465,007 (GRCm38) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,474,172 (GRCm38) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,443,004 (GRCm38) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,421,468 (GRCm38) missense probably benign 0.34
attrition UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
defame UTSW 11 119,430,281 (GRCm38) nonsense probably null
Derogate UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
dinky UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,434,742 (GRCm38) missense
Impugn UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,426,069 (GRCm38) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
PIT4585001:Rnf213 UTSW 11 119,458,392 (GRCm38) missense
R0008:Rnf213 UTSW 11 119,465,052 (GRCm38) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,441,606 (GRCm38) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,402,575 (GRCm38) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,414,587 (GRCm38) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,416,496 (GRCm38) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,479,600 (GRCm38) nonsense probably null
R0184:Rnf213 UTSW 11 119,414,521 (GRCm38) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,438,105 (GRCm38) nonsense probably null
R0365:Rnf213 UTSW 11 119,426,111 (GRCm38) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,447,257 (GRCm38) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,426,012 (GRCm38) missense possibly damaging 0.65
R0549:Rnf213 UTSW 11 119,465,082 (GRCm38) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,443,280 (GRCm38) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,431,717 (GRCm38) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,441,834 (GRCm38) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,441,150 (GRCm38) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,441,068 (GRCm38) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,473,480 (GRCm38) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,423,095 (GRCm38) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,430,486 (GRCm38) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,414,570 (GRCm38) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,416,563 (GRCm38) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,452,581 (GRCm38) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,485,998 (GRCm38) splice site probably benign
R1104:Rnf213 UTSW 11 119,477,229 (GRCm38) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,435,983 (GRCm38) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,436,177 (GRCm38) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,436,005 (GRCm38) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,442,400 (GRCm38) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,437,750 (GRCm38) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,480,889 (GRCm38) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,441,888 (GRCm38) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,442,707 (GRCm38) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,441,839 (GRCm38) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,414,526 (GRCm38) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,436,611 (GRCm38) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,463,345 (GRCm38) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,442,579 (GRCm38) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,437,672 (GRCm38) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,440,221 (GRCm38) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,441,183 (GRCm38) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,450,129 (GRCm38) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,416,448 (GRCm38) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,431,685 (GRCm38) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,480,895 (GRCm38) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,441,107 (GRCm38) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,436,022 (GRCm38) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,461,918 (GRCm38) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,467,302 (GRCm38) nonsense probably null
R2109:Rnf213 UTSW 11 119,442,663 (GRCm38) nonsense probably null
R2115:Rnf213 UTSW 11 119,428,013 (GRCm38) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,450,201 (GRCm38) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,443,690 (GRCm38) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,415,193 (GRCm38) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,415,070 (GRCm38) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,460,009 (GRCm38) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,436,428 (GRCm38) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,414,604 (GRCm38) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,443,195 (GRCm38) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,459,938 (GRCm38) splice site probably null
R2698:Rnf213 UTSW 11 119,410,144 (GRCm38) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,468,892 (GRCm38) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,441,976 (GRCm38) nonsense probably null
R3808:Rnf213 UTSW 11 119,479,558 (GRCm38) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3856:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3973:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R4014:Rnf213 UTSW 11 119,445,729 (GRCm38) nonsense probably null
R4049:Rnf213 UTSW 11 119,482,448 (GRCm38) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,483,006 (GRCm38) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,409,482 (GRCm38) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,441,243 (GRCm38) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332:Rnf213 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,483,964 (GRCm38) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,479,670 (GRCm38) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,437,695 (GRCm38) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,441,125 (GRCm38) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,440,349 (GRCm38) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,445,745 (GRCm38) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,416,629 (GRCm38) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,442,763 (GRCm38) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,481,240 (GRCm38) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,428,157 (GRCm38) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,436,764 (GRCm38) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,410,807 (GRCm38) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,458,866 (GRCm38) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,440,816 (GRCm38) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,440,808 (GRCm38) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,409,020 (GRCm38) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,415,076 (GRCm38) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,433,499 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,905 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,629 (GRCm38) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,458,785 (GRCm38) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,434,686 (GRCm38) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,483,894 (GRCm38) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,436,295 (GRCm38) missense probably benign
R5861:Rnf213 UTSW 11 119,473,377 (GRCm38) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,421,369 (GRCm38) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,443,079 (GRCm38) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,486,010 (GRCm38) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,442,101 (GRCm38) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,416,559 (GRCm38) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,411,513 (GRCm38) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,411,470 (GRCm38) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,442,028 (GRCm38) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,435,999 (GRCm38) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,458,428 (GRCm38) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,414,548 (GRCm38) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,463,366 (GRCm38) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,477,078 (GRCm38) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,459,966 (GRCm38) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,452,687 (GRCm38) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,436,280 (GRCm38) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,479,920 (GRCm38) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,442,271 (GRCm38) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,442,236 (GRCm38) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,462,285 (GRCm38) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,448,838 (GRCm38) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,449,866 (GRCm38) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,479,655 (GRCm38) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,437,604 (GRCm38) splice site probably null
R7170:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7185:Rnf213 UTSW 11 119,424,198 (GRCm38) missense
R7239:Rnf213 UTSW 11 119,458,788 (GRCm38) missense
R7258:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7259:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7260:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7273:Rnf213 UTSW 11 119,431,756 (GRCm38) splice site probably null
R7282:Rnf213 UTSW 11 119,437,992 (GRCm38) missense
R7311:Rnf213 UTSW 11 119,416,547 (GRCm38) missense
R7352:Rnf213 UTSW 11 119,443,579 (GRCm38) missense
R7369:Rnf213 UTSW 11 119,430,468 (GRCm38) missense
R7410:Rnf213 UTSW 11 119,435,051 (GRCm38) missense
R7448:Rnf213 UTSW 11 119,481,291 (GRCm38) missense
R7561:Rnf213 UTSW 11 119,441,719 (GRCm38) missense
R7573:Rnf213 UTSW 11 119,458,484 (GRCm38) missense
R7615:Rnf213 UTSW 11 119,467,297 (GRCm38) missense
R7680:Rnf213 UTSW 11 119,479,556 (GRCm38) missense
R7739:Rnf213 UTSW 11 119,410,861 (GRCm38) missense
R7789:Rnf213 UTSW 11 119,470,219 (GRCm38) splice site probably null
R7806:Rnf213 UTSW 11 119,411,545 (GRCm38) missense
R8031:Rnf213 UTSW 11 119,430,281 (GRCm38) nonsense probably null
R8042:Rnf213 UTSW 11 119,441,654 (GRCm38) missense
R8053:Rnf213 UTSW 11 119,402,647 (GRCm38) missense
R8284:Rnf213 UTSW 11 119,428,083 (GRCm38) missense
R8301:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
R8325:Rnf213 UTSW 11 119,430,445 (GRCm38) missense
R8332:Rnf213 UTSW 11 119,483,698 (GRCm38) missense
R8443:Rnf213 UTSW 11 119,449,323 (GRCm38) missense
R8518:Rnf213 UTSW 11 119,462,217 (GRCm38) missense
R8531:Rnf213 UTSW 11 119,474,205 (GRCm38) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,458,737 (GRCm38) missense
R8675:Rnf213 UTSW 11 119,456,158 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,441,212 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,418,129 (GRCm38) missense
R8714:Rnf213 UTSW 11 119,468,894 (GRCm38) missense
R8802:Rnf213 UTSW 11 119,462,102 (GRCm38) missense
R8861:Rnf213 UTSW 11 119,442,236 (GRCm38) missense
R8886:Rnf213 UTSW 11 119,473,438 (GRCm38) missense
R8893:Rnf213 UTSW 11 119,443,042 (GRCm38) missense
R8937:Rnf213 UTSW 11 119,430,274 (GRCm38) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,414,424 (GRCm38) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,461,930 (GRCm38) missense
R8983:Rnf213 UTSW 11 119,430,349 (GRCm38) missense
R9043:Rnf213 UTSW 11 119,458,913 (GRCm38) missense
R9081:Rnf213 UTSW 11 119,466,236 (GRCm38) missense
R9132:Rnf213 UTSW 11 119,483,916 (GRCm38) missense
R9135:Rnf213 UTSW 11 119,408,747 (GRCm38) missense
R9146:Rnf213 UTSW 11 119,443,673 (GRCm38) missense
R9156:Rnf213 UTSW 11 119,440,748 (GRCm38) missense
R9183:Rnf213 UTSW 11 119,427,622 (GRCm38) missense
R9234:Rnf213 UTSW 11 119,450,117 (GRCm38) missense
R9275:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9278:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9296:Rnf213 UTSW 11 119,443,795 (GRCm38) splice site probably benign
R9350:Rnf213 UTSW 11 119,442,149 (GRCm38) missense
R9366:Rnf213 UTSW 11 119,436,231 (GRCm38) missense
R9413:Rnf213 UTSW 11 119,466,233 (GRCm38) missense
R9444:Rnf213 UTSW 11 119,434,797 (GRCm38) missense
R9464:Rnf213 UTSW 11 119,463,580 (GRCm38) missense
R9605:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R9649:Rnf213 UTSW 11 119,479,631 (GRCm38) missense
R9651:Rnf213 UTSW 11 119,440,412 (GRCm38) missense
R9664:Rnf213 UTSW 11 119,441,968 (GRCm38) missense
R9696:Rnf213 UTSW 11 119,468,980 (GRCm38) missense
R9710:Rnf213 UTSW 11 119,441,005 (GRCm38) missense
R9797:Rnf213 UTSW 11 119,442,539 (GRCm38) missense
S24628:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,441,824 (GRCm38) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,473,513 (GRCm38) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,440,463 (GRCm38) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,477,254 (GRCm38) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,482,998 (GRCm38) missense
Z1176:Rnf213 UTSW 11 119,441,410 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TACTTGCTCGTGCTGACCAGGAAC -3'
(R):5'- TACATCTGCGAACTCGTGTGCC -3'

Sequencing Primer
(F):5'- TGCTGACCAGGAACTATGTG -3'
(R):5'- AGCACAGTGTTCATGTCCAG -3'
Posted On 2013-05-23