Incidental Mutation 'R5425:Aldh1a2'
ID426827
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71253004 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 104 (R104H)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect probably benign
Transcript: ENSMUST00000034723
AA Change: R104H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: R104H

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Ankmy1 G T 1: 92,870,957 Y20* probably null Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Csf1 A G 3: 107,748,896 L273P possibly damaging Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Faah A T 4: 116,000,796 M436K probably null Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Ffar1 A C 7: 30,860,779 L231R probably damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Ttc41 A T 10: 86,776,630 I1256F probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGATGACAGCATGTAGGGC -3'
(R):5'- GAGCTTCCCTAAAGACCTCTC -3'

Sequencing Primer
(F):5'- ACAGCATGTAGGGCTTGTG -3'
(R):5'- CCTAAAGACCTCTCATATTTTGTGTG -3'
Posted On2016-09-01