Incidental Mutation 'R5425:Ttc41'
ID426829
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Nametetratricopeptide repeat domain 41
SynonymsGnn, BC030307
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86705811-86776844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86776630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1256 (I1256F)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000099396]
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: I1256F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: I1256F

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099396
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh1a2 G A 9: 71,253,004 R104H probably benign Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Ankmy1 G T 1: 92,870,957 Y20* probably null Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Csf1 A G 3: 107,748,896 L273P possibly damaging Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Faah A T 4: 116,000,796 M436K probably null Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Ffar1 A C 7: 30,860,779 L231R probably damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGTCAGGCTTCAGACTCAC -3'
(R):5'- GTGTGCACACTTGTACCACAC -3'

Sequencing Primer
(F):5'- GTCAGGCTTCAGACTCACAAATATGG -3'
(R):5'- CATACGCCTTTCAAGAGAAATGAG -3'
Posted On2016-09-01