Incidental Mutation 'R5426:Slco4a1'
ID426862
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Namesolute carrier organic anion transporter family, member 4a1
SynonymsSlc21a12, OATP-E
MMRRC Submission 042992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180456245-180474867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 180471235 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 420 (A420D)
Ref Sequence ENSEMBL: ENSMUSP00000046502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038225
AA Change: A420D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: A420D

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038259
AA Change: A420D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: A420D

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139902
Meta Mutation Damage Score 0.7790 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
C87499 T A 4: 88,629,410 probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dnah7b T C 1: 46,242,206 M2809T possibly damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
Dsg4 T C 18: 20,458,484 Y427H probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kalrn A T 16: 34,262,653 V644D probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sept7 T A 9: 25,286,690 I100N possibly damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8203:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGGCAGGTTCCTTGCATG -3'
(R):5'- GGCCCAAACCCTTTCTGTAAG -3'

Sequencing Primer
(F):5'- GCAGGTTCCTTGCATGCAGTC -3'
(R):5'- CTTTCTGTAAGGAGTGGTAGGTAAAG -3'
Posted On2016-09-01