Incidental Mutation 'R5426:Pramel32'
ID 426867
Institutional Source Beutler Lab
Gene Symbol Pramel32
Ensembl Gene ENSMUSG00000038330
Gene Name PRAME like 32
Synonyms C87499
MMRRC Submission 042992-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.394) question?
Stock # R5426 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 88545557-88552423 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 88547647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
AlphaFold Q3UX49
Predicted Effect probably benign
Transcript: ENSMUST00000053304
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
Predicted Effect probably benign
Transcript: ENSMUST00000107143
Predicted Effect probably benign
Transcript: ENSMUST00000134155
Predicted Effect unknown
Transcript: ENSMUST00000156062
AA Change: D8V
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,633 (GRCm39) H122L probably damaging Het
9330182O14Rik G A 15: 40,011,932 (GRCm39) M90I unknown Het
9330182O14Rik G A 15: 40,011,933 (GRCm39) D91N unknown Het
Abca13 T A 11: 9,240,722 (GRCm39) S862T probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgb C A 10: 10,226,004 (GRCm39) A1405S probably benign Het
Adpgk T A 9: 59,204,832 (GRCm39) V86E probably damaging Het
Agfg2 G C 5: 137,666,020 (GRCm39) P80A probably damaging Het
Akap11 G A 14: 78,736,304 (GRCm39) Q1829* probably null Het
Aldh1l1 G A 6: 90,536,281 (GRCm39) R62Q probably benign Het
Amd1 G T 10: 40,166,183 (GRCm39) D265E probably damaging Het
Aox4 A T 1: 58,259,253 (GRCm39) Q106L probably damaging Het
Arap2 A T 5: 62,800,159 (GRCm39) N1289K probably benign Het
Arhgef12 T C 9: 42,897,880 (GRCm39) S874G probably damaging Het
Ccdc166 T C 15: 75,853,945 (GRCm39) Q45R possibly damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Cdk14 A G 5: 4,938,975 (GRCm39) S388P possibly damaging Het
Chgb A T 2: 132,635,453 (GRCm39) Q465L possibly damaging Het
Commd9 T A 2: 101,729,220 (GRCm39) W109R probably damaging Het
Cspg4b G A 13: 113,505,587 (GRCm39) V2239I probably benign Het
Cyp2b9 T C 7: 25,887,080 (GRCm39) V163A probably benign Het
Dcpp2 T A 17: 24,118,287 (GRCm39) H27Q possibly damaging Het
Ddn T A 15: 98,704,347 (GRCm39) E315V possibly damaging Het
Defb29 C A 2: 152,380,868 (GRCm39) C47F probably damaging Het
Dnah7b T C 1: 46,281,366 (GRCm39) M2809T possibly damaging Het
Dock4 A T 12: 40,795,744 (GRCm39) I854F probably damaging Het
Dsg4 T C 18: 20,591,541 (GRCm39) Y427H probably damaging Het
E130114P18Rik C T 4: 97,578,907 (GRCm39) A23T unknown Het
Flacc1 T A 1: 58,706,045 (GRCm39) K275* probably null Het
Gemin5 A G 11: 58,016,113 (GRCm39) S1297P probably benign Het
Gm10309 A C 17: 86,806,161 (GRCm39) probably benign Het
Gpatch11 T A 17: 79,148,663 (GRCm39) S155R possibly damaging Het
Grin2b C A 6: 135,709,366 (GRCm39) Q1393H probably damaging Het
Heatr5b C T 17: 79,081,142 (GRCm39) C1370Y probably damaging Het
Hmcn2 C T 2: 31,226,556 (GRCm39) T177I possibly damaging Het
Ildr1 A T 16: 36,529,981 (GRCm39) I123F probably damaging Het
Kalrn A T 16: 34,083,023 (GRCm39) V644D probably damaging Het
Kifap3 A G 1: 163,607,440 (GRCm39) M1V probably null Het
Klhl11 A G 11: 100,354,942 (GRCm39) L293P probably damaging Het
Klrc3 G A 6: 129,618,513 (GRCm39) S98L probably benign Het
Lrrc37 A T 11: 103,511,586 (GRCm39) H127Q unknown Het
Med12l G A 3: 59,156,143 (GRCm39) M1220I probably damaging Het
Ms4a7 C T 19: 11,303,166 (GRCm39) probably null Het
Mybpc2 A G 7: 44,159,253 (GRCm39) V599A probably benign Het
Naalad2 T C 9: 18,258,815 (GRCm39) N487D probably benign Het
Nat8f7 T G 6: 85,684,805 (GRCm39) S12R probably benign Het
Nefm T A 14: 68,357,515 (GRCm39) probably benign Het
Nlrp5 T C 7: 23,117,626 (GRCm39) V450A probably damaging Het
Nps G A 7: 134,870,376 (GRCm39) probably null Het
Or13c7d A G 4: 43,770,168 (GRCm39) I281T probably benign Het
Or2ag16 C A 7: 106,351,773 (GRCm39) S274I probably benign Het
Or4a74 T C 2: 89,440,083 (GRCm39) Y121C probably damaging Het
Or4b13 T A 2: 90,082,955 (GRCm39) K126* probably null Het
Or5e1 T C 7: 108,354,924 (GRCm39) L287P possibly damaging Het
Or5h24 G T 16: 58,918,665 (GRCm39) P230Q possibly damaging Het
Or5p67 T C 7: 107,922,017 (GRCm39) N289D probably damaging Het
Oxct2a C A 4: 123,216,506 (GRCm39) G292W possibly damaging Het
Prr27 T C 5: 87,998,744 (GRCm39) probably benign Het
Ptx3 T C 3: 66,128,143 (GRCm39) M68T probably damaging Het
Rufy1 A G 11: 50,312,561 (GRCm39) L131S probably damaging Het
Septin7 T A 9: 25,197,986 (GRCm39) I100N possibly damaging Het
Sgms2 T C 3: 131,135,446 (GRCm39) I143V probably benign Het
Slc25a34 A G 4: 141,350,877 (GRCm39) V44A probably damaging Het
Slc28a3 T A 13: 58,710,968 (GRCm39) D518V probably damaging Het
Slc6a7 C T 18: 61,136,308 (GRCm39) probably null Het
Slco4a1 C A 2: 180,113,028 (GRCm39) A420D possibly damaging Het
Smap1 T C 1: 23,888,471 (GRCm39) T180A probably benign Het
Specc1l T C 10: 75,103,384 (GRCm39) S920P probably benign Het
Tgtp2 A G 11: 48,950,083 (GRCm39) M163T probably benign Het
Tiam1 G T 16: 89,662,280 (GRCm39) Q613K possibly damaging Het
Vsig10l T A 7: 43,114,247 (GRCm39) S190T probably damaging Het
Vwa3b A G 1: 37,154,752 (GRCm39) Y512C probably damaging Het
Wdfy3 T A 5: 102,067,312 (GRCm39) N1207Y probably damaging Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Wdr70 A G 15: 7,951,586 (GRCm39) L417S possibly damaging Het
Wdr81 A C 11: 75,341,722 (GRCm39) S1182A possibly damaging Het
Zfp458 A T 13: 67,405,256 (GRCm39) C391* probably null Het
Zfp638 A G 6: 83,953,396 (GRCm39) E1167G probably damaging Het
Zfp763 T A 17: 33,238,569 (GRCm39) D192V probably benign Het
Zfp853 T G 5: 143,274,624 (GRCm39) Q332P unknown Het
Other mutations in Pramel32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Pramel32 APN 4 88,547,307 (GRCm39) missense probably benign 0.43
IGL00229:Pramel32 APN 4 88,547,290 (GRCm39) missense probably damaging 0.99
IGL01938:Pramel32 APN 4 88,547,600 (GRCm39) missense possibly damaging 0.90
IGL02321:Pramel32 APN 4 88,548,340 (GRCm39) missense probably benign 0.33
IGL02351:Pramel32 APN 4 88,546,127 (GRCm39) missense probably damaging 1.00
IGL02358:Pramel32 APN 4 88,546,127 (GRCm39) missense probably damaging 1.00
P0005:Pramel32 UTSW 4 88,546,187 (GRCm39) missense probably damaging 1.00
R0521:Pramel32 UTSW 4 88,547,559 (GRCm39) missense probably damaging 0.96
R0578:Pramel32 UTSW 4 88,552,376 (GRCm39) missense probably benign 0.01
R0600:Pramel32 UTSW 4 88,547,536 (GRCm39) missense probably damaging 1.00
R0750:Pramel32 UTSW 4 88,545,905 (GRCm39) missense probably benign 0.01
R1483:Pramel32 UTSW 4 88,547,071 (GRCm39) missense probably damaging 1.00
R1502:Pramel32 UTSW 4 88,546,269 (GRCm39) missense probably benign 0.00
R1911:Pramel32 UTSW 4 88,548,309 (GRCm39) missense possibly damaging 0.93
R2204:Pramel32 UTSW 4 88,546,355 (GRCm39) missense probably damaging 0.99
R2507:Pramel32 UTSW 4 88,547,448 (GRCm39) missense possibly damaging 0.89
R2512:Pramel32 UTSW 4 88,547,195 (GRCm39) missense probably damaging 0.99
R4299:Pramel32 UTSW 4 88,546,419 (GRCm39) missense probably damaging 0.97
R4498:Pramel32 UTSW 4 88,547,129 (GRCm39) splice site probably null
R4656:Pramel32 UTSW 4 88,548,202 (GRCm39) missense probably benign 0.41
R4787:Pramel32 UTSW 4 88,547,450 (GRCm39) nonsense probably null
R4823:Pramel32 UTSW 4 88,547,452 (GRCm39) missense probably damaging 1.00
R4885:Pramel32 UTSW 4 88,546,219 (GRCm39) missense possibly damaging 0.50
R4948:Pramel32 UTSW 4 88,547,185 (GRCm39) missense probably damaging 1.00
R4967:Pramel32 UTSW 4 88,547,432 (GRCm39) missense probably damaging 1.00
R5229:Pramel32 UTSW 4 88,548,372 (GRCm39) missense possibly damaging 0.92
R5520:Pramel32 UTSW 4 88,548,277 (GRCm39) missense probably damaging 1.00
R5574:Pramel32 UTSW 4 88,546,280 (GRCm39) missense probably benign 0.10
R5596:Pramel32 UTSW 4 88,548,292 (GRCm39) missense probably damaging 1.00
R6282:Pramel32 UTSW 4 88,548,291 (GRCm39) missense probably damaging 1.00
R6366:Pramel32 UTSW 4 88,547,102 (GRCm39) missense probably damaging 0.99
R6808:Pramel32 UTSW 4 88,548,291 (GRCm39) missense probably damaging 1.00
R6866:Pramel32 UTSW 4 88,545,977 (GRCm39) missense probably damaging 1.00
R7105:Pramel32 UTSW 4 88,548,339 (GRCm39) missense probably damaging 0.98
R7117:Pramel32 UTSW 4 88,547,195 (GRCm39) missense probably damaging 0.99
R7319:Pramel32 UTSW 4 88,548,184 (GRCm39) missense probably benign 0.25
R7345:Pramel32 UTSW 4 88,546,416 (GRCm39) missense possibly damaging 0.88
R7399:Pramel32 UTSW 4 88,546,202 (GRCm39) missense probably benign 0.01
R7626:Pramel32 UTSW 4 88,548,279 (GRCm39) missense probably damaging 1.00
R7751:Pramel32 UTSW 4 88,547,356 (GRCm39) missense probably benign 0.05
R8044:Pramel32 UTSW 4 88,548,212 (GRCm39) missense possibly damaging 0.47
R8849:Pramel32 UTSW 4 88,546,014 (GRCm39) missense probably benign 0.03
R9334:Pramel32 UTSW 4 88,548,186 (GRCm39) missense probably damaging 0.99
R9515:Pramel32 UTSW 4 88,546,219 (GRCm39) missense possibly damaging 0.50
RF012:Pramel32 UTSW 4 88,546,006 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGACTATTCTCCACTGGC -3'
(R):5'- TGCAGAATGGGCATTTCCATG -3'

Sequencing Primer
(F):5'- ACTGGCTGCTTCTGTGTCAAC -3'
(R):5'- CATTTCCATGCATACCTGAAAGG -3'
Posted On 2016-09-01