Mutagenetix > Incidental Mutations

Incidental Mutation 'R5426:Arap2'

426872

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

042992-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62642816 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1289 (N1289K)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

Predicted Effect

probably benign
Transcript: ENSMUST00000076623
AA Change: N1289K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: N1289K

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200549

Meta Mutation Damage Score

0.0700

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,003	H122L	probably damaging	Het
9330182O14Rik	G	A	15: 40,148,536	M90I	unknown	Het
9330182O14Rik	G	A	15: 40,148,537	D91N	unknown	Het
Abca13	T	A	11: 9,290,722	S862T	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgb	C	A	10: 10,350,260	A1405S	probably benign	Het
Adpgk	T	A	9: 59,297,549	V86E	probably damaging	Het
Agfg2	G	C	5: 137,667,758	P80A	probably damaging	Het
Akap11	G	A	14: 78,498,864	Q1829*	probably null	Het
Aldh1l1	G	A	6: 90,559,299	R62Q	probably benign	Het
Als2cr12	T	A	1: 58,666,886	K275*	probably null	Het
Amd1	G	T	10: 40,290,187	D265E	probably damaging	Het
Aox4	A	T	1: 58,220,094	Q106L	probably damaging	Het
Arhgef12	T	C	9: 42,986,584	S874G	probably damaging	Het
BC067074	G	A	13: 113,369,053	V2239I	probably benign	Het
C87499	T	A	4: 88,629,410		probably benign	Het
Ccdc166	T	C	15: 75,982,096	Q45R	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk14	A	G	5: 4,888,975	S388P	possibly damaging	Het
Chgb	A	T	2: 132,793,533	Q465L	possibly damaging	Het
Commd9	T	A	2: 101,898,875	W109R	probably damaging	Het
Cyp2b9	T	C	7: 26,187,655	V163A	probably benign	Het
Dcpp2	T	A	17: 23,899,313	H27Q	possibly damaging	Het
Ddn	T	A	15: 98,806,466	E315V	possibly damaging	Het
Defb29	C	A	2: 152,538,948	C47F	probably damaging	Het
Dnah7b	T	C	1: 46,242,206	M2809T	possibly damaging	Het
Dock4	A	T	12: 40,745,745	I854F	probably damaging	Het
Dsg4	T	C	18: 20,458,484	Y427H	probably damaging	Het
E130114P18Rik	C	T	4: 97,690,670	A23T	unknown	Het
Gemin5	A	G	11: 58,125,287	S1297P	probably benign	Het
Gm10309	A	C	17: 86,498,733		probably benign	Het
Gm884	A	T	11: 103,620,760	H127Q	unknown	Het
Gpatch11	T	A	17: 78,841,234	S155R	possibly damaging	Het
Grin2b	C	A	6: 135,732,368	Q1393H	probably damaging	Het
Heatr5b	C	T	17: 78,773,713	C1370Y	probably damaging	Het
Hmcn2	C	T	2: 31,336,544	T177I	possibly damaging	Het
Ildr1	A	T	16: 36,709,619	I123F	probably damaging	Het
Kalrn	A	T	16: 34,262,653	V644D	probably damaging	Het
Kifap3	A	G	1: 163,779,871	M1V	probably null	Het
Klhl11	A	G	11: 100,464,116	L293P	probably damaging	Het
Klrc3	G	A	6: 129,641,550	S98L	probably benign	Het
Med12l	G	A	3: 59,248,722	M1220I	probably damaging	Het
Ms4a7	C	T	19: 11,325,802		probably null	Het
Mybpc2	A	G	7: 44,509,829	V599A	probably benign	Het
Naalad2	T	C	9: 18,347,519	N487D	probably benign	Het
Nat8f7	T	G	6: 85,707,823	S12R	probably benign	Het
Nefm	T	A	14: 68,120,066		probably benign	Het
Nlrp5	T	C	7: 23,418,201	V450A	probably damaging	Het
Nps	G	A	7: 135,268,647		probably null	Het
Olfr1247	T	C	2: 89,609,739	Y121C	probably damaging	Het
Olfr142	T	A	2: 90,252,611	K126*	probably null	Het
Olfr159	A	G	4: 43,770,168	I281T	probably benign	Het
Olfr192	G	T	16: 59,098,302	P230Q	possibly damaging	Het
Olfr492	T	C	7: 108,322,810	N289D	probably damaging	Het
Olfr513	T	C	7: 108,755,717	L287P	possibly damaging	Het
Olfr698	C	A	7: 106,752,566	S274I	probably benign	Het
Oxct2a	C	A	4: 123,322,713	G292W	possibly damaging	Het
Prr27	T	C	5: 87,850,885		probably benign	Het
Ptx3	T	C	3: 66,220,722	M68T	probably damaging	Het
Rufy1	A	G	11: 50,421,734	L131S	probably damaging	Het
Sept7	T	A	9: 25,286,690	I100N	possibly damaging	Het
Sgms2	T	C	3: 131,341,797	I143V	probably benign	Het
Slc25a34	A	G	4: 141,623,566	V44A	probably damaging	Het
Slc28a3	T	A	13: 58,563,154	D518V	probably damaging	Het
Slc6a7	C	T	18: 61,003,236		probably null	Het
Slco4a1	C	A	2: 180,471,235	A420D	possibly damaging	Het
Smap1	T	C	1: 23,849,390	T180A	probably benign	Het
Specc1l	T	C	10: 75,267,550	S920P	probably benign	Het
Tgtp2	A	G	11: 49,059,256	M163T	probably benign	Het
Tiam1	G	T	16: 89,865,392	Q613K	possibly damaging	Het
Vsig10l	T	A	7: 43,464,823	S190T	probably damaging	Het
Vwa3b	A	G	1: 37,115,671	Y512C	probably damaging	Het
Wdfy3	T	A	5: 101,919,446	N1207Y	probably damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Wdr70	A	G	15: 7,922,105	L417S	possibly damaging	Het
Wdr81	A	C	11: 75,450,896	S1182A	possibly damaging	Het
Zfp458	A	T	13: 67,257,192	C391*	probably null	Het
Zfp638	A	G	6: 83,976,414	E1167G	probably damaging	Het
Zfp763	T	A	17: 33,019,595	D192V	probably benign	Het
Zfp853	T	G	5: 143,288,869	Q332P	unknown	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0551:Arap2	UTSW	5	62641323	splice site	probably null
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62749094	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62676549	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62730705	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62730611	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62621981	splice site	probably null
R8277:Arap2	UTSW	5	62613992	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62604326	nonsense	probably null
R8398:Arap2	UTSW	5	62748909	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAATAGTATGCTGTCCAAC -3'
(R):5'- GGCTGCTCCTTTGAACAGTAG -3'

Sequencing Primer
(F):5'- GGTGAAAATATTTAAAGGCTGCTGC -3'
(R):5'- TCGAAGAACTTCAAACCGTGTGTG -3'

Posted On

2016-09-01