Incidental Mutation 'R5426:Sept7'
ID426890
Institutional Source Beutler Lab
Gene Symbol Sept7
Ensembl Gene ENSMUSG00000001833
Gene Nameseptin 7
SynonymsCdc10
MMRRC Submission 042992-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location25252439-25308571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25286690 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 100 (I100N)
Ref Sequence ENSEMBL: ENSMUSP00000127641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115272
AA Change: I100N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.7e-126 PFAM
Pfam:MMR_HSR1 52 252 2.5e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165594
AA Change: I100N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.6e-126 PFAM
Pfam:MMR_HSR1 52 197 4.9e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217598
Meta Mutation Damage Score 0.2469 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
C87499 T A 4: 88,629,410 probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dnah7b T C 1: 46,242,206 M2809T possibly damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
Dsg4 T C 18: 20,458,484 Y427H probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kalrn A T 16: 34,262,653 V644D probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Slco4a1 C A 2: 180,471,235 A420D possibly damaging Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in Sept7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Sept7 APN 9 25296490 splice site probably benign
R0331:Sept7 UTSW 9 25306256 missense probably benign 0.00
R1590:Sept7 UTSW 9 25277604 missense probably damaging 0.99
R2040:Sept7 UTSW 9 25288236 missense possibly damaging 0.79
R4935:Sept7 UTSW 9 25306172 missense probably benign 0.03
R5246:Sept7 UTSW 9 25299536 missense probably damaging 1.00
R5629:Sept7 UTSW 9 25288293 missense probably damaging 1.00
R5994:Sept7 UTSW 9 25288198 missense possibly damaging 0.52
R6177:Sept7 UTSW 9 25293804 critical splice donor site probably null
R6246:Sept7 UTSW 9 25307521 missense probably benign 0.00
R6735:Sept7 UTSW 9 25303752 missense possibly damaging 0.94
R7561:Sept7 UTSW 9 25297855 missense possibly damaging 0.77
R7837:Sept7 UTSW 9 25288235 missense possibly damaging 0.92
X0066:Sept7 UTSW 9 25306140 missense possibly damaging 0.88
Z1176:Sept7 UTSW 9 25252556 start gained probably benign
Z1177:Sept7 UTSW 9 25301423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGACCTAGTGTGTATGGCAGAG -3'
(R):5'- GTTGGTATGTGAGCAAGCCC -3'

Sequencing Primer
(F):5'- ATCTGGGTTCAATTAAGAGGCCC -3'
(R):5'- TGGTATGTGAGCAAGCCCTAATC -3'
Posted On2016-09-01