Incidental Mutation 'R5426:Wdr70'
ID 426913
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene Name WD repeat domain 70
Synonyms 4833422F06Rik
MMRRC Submission 042992-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R5426 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7902536-8128693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7951586 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 417 (L417S)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045766
AA Change: L417S

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: L417S

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,633 (GRCm39) H122L probably damaging Het
9330182O14Rik G A 15: 40,011,932 (GRCm39) M90I unknown Het
9330182O14Rik G A 15: 40,011,933 (GRCm39) D91N unknown Het
Abca13 T A 11: 9,240,722 (GRCm39) S862T probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgb C A 10: 10,226,004 (GRCm39) A1405S probably benign Het
Adpgk T A 9: 59,204,832 (GRCm39) V86E probably damaging Het
Agfg2 G C 5: 137,666,020 (GRCm39) P80A probably damaging Het
Akap11 G A 14: 78,736,304 (GRCm39) Q1829* probably null Het
Aldh1l1 G A 6: 90,536,281 (GRCm39) R62Q probably benign Het
Amd1 G T 10: 40,166,183 (GRCm39) D265E probably damaging Het
Aox4 A T 1: 58,259,253 (GRCm39) Q106L probably damaging Het
Arap2 A T 5: 62,800,159 (GRCm39) N1289K probably benign Het
Arhgef12 T C 9: 42,897,880 (GRCm39) S874G probably damaging Het
Ccdc166 T C 15: 75,853,945 (GRCm39) Q45R possibly damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Cdk14 A G 5: 4,938,975 (GRCm39) S388P possibly damaging Het
Chgb A T 2: 132,635,453 (GRCm39) Q465L possibly damaging Het
Commd9 T A 2: 101,729,220 (GRCm39) W109R probably damaging Het
Cspg4b G A 13: 113,505,587 (GRCm39) V2239I probably benign Het
Cyp2b9 T C 7: 25,887,080 (GRCm39) V163A probably benign Het
Dcpp2 T A 17: 24,118,287 (GRCm39) H27Q possibly damaging Het
Ddn T A 15: 98,704,347 (GRCm39) E315V possibly damaging Het
Defb29 C A 2: 152,380,868 (GRCm39) C47F probably damaging Het
Dnah7b T C 1: 46,281,366 (GRCm39) M2809T possibly damaging Het
Dock4 A T 12: 40,795,744 (GRCm39) I854F probably damaging Het
Dsg4 T C 18: 20,591,541 (GRCm39) Y427H probably damaging Het
E130114P18Rik C T 4: 97,578,907 (GRCm39) A23T unknown Het
Flacc1 T A 1: 58,706,045 (GRCm39) K275* probably null Het
Gemin5 A G 11: 58,016,113 (GRCm39) S1297P probably benign Het
Gm10309 A C 17: 86,806,161 (GRCm39) probably benign Het
Gpatch11 T A 17: 79,148,663 (GRCm39) S155R possibly damaging Het
Grin2b C A 6: 135,709,366 (GRCm39) Q1393H probably damaging Het
Heatr5b C T 17: 79,081,142 (GRCm39) C1370Y probably damaging Het
Hmcn2 C T 2: 31,226,556 (GRCm39) T177I possibly damaging Het
Ildr1 A T 16: 36,529,981 (GRCm39) I123F probably damaging Het
Kalrn A T 16: 34,083,023 (GRCm39) V644D probably damaging Het
Kifap3 A G 1: 163,607,440 (GRCm39) M1V probably null Het
Klhl11 A G 11: 100,354,942 (GRCm39) L293P probably damaging Het
Klrc3 G A 6: 129,618,513 (GRCm39) S98L probably benign Het
Lrrc37 A T 11: 103,511,586 (GRCm39) H127Q unknown Het
Med12l G A 3: 59,156,143 (GRCm39) M1220I probably damaging Het
Ms4a7 C T 19: 11,303,166 (GRCm39) probably null Het
Mybpc2 A G 7: 44,159,253 (GRCm39) V599A probably benign Het
Naalad2 T C 9: 18,258,815 (GRCm39) N487D probably benign Het
Nat8f7 T G 6: 85,684,805 (GRCm39) S12R probably benign Het
Nefm T A 14: 68,357,515 (GRCm39) probably benign Het
Nlrp5 T C 7: 23,117,626 (GRCm39) V450A probably damaging Het
Nps G A 7: 134,870,376 (GRCm39) probably null Het
Or13c7d A G 4: 43,770,168 (GRCm39) I281T probably benign Het
Or2ag16 C A 7: 106,351,773 (GRCm39) S274I probably benign Het
Or4a74 T C 2: 89,440,083 (GRCm39) Y121C probably damaging Het
Or4b13 T A 2: 90,082,955 (GRCm39) K126* probably null Het
Or5e1 T C 7: 108,354,924 (GRCm39) L287P possibly damaging Het
Or5h24 G T 16: 58,918,665 (GRCm39) P230Q possibly damaging Het
Or5p67 T C 7: 107,922,017 (GRCm39) N289D probably damaging Het
Oxct2a C A 4: 123,216,506 (GRCm39) G292W possibly damaging Het
Pramel32 T A 4: 88,547,647 (GRCm39) probably benign Het
Prr27 T C 5: 87,998,744 (GRCm39) probably benign Het
Ptx3 T C 3: 66,128,143 (GRCm39) M68T probably damaging Het
Rufy1 A G 11: 50,312,561 (GRCm39) L131S probably damaging Het
Septin7 T A 9: 25,197,986 (GRCm39) I100N possibly damaging Het
Sgms2 T C 3: 131,135,446 (GRCm39) I143V probably benign Het
Slc25a34 A G 4: 141,350,877 (GRCm39) V44A probably damaging Het
Slc28a3 T A 13: 58,710,968 (GRCm39) D518V probably damaging Het
Slc6a7 C T 18: 61,136,308 (GRCm39) probably null Het
Slco4a1 C A 2: 180,113,028 (GRCm39) A420D possibly damaging Het
Smap1 T C 1: 23,888,471 (GRCm39) T180A probably benign Het
Specc1l T C 10: 75,103,384 (GRCm39) S920P probably benign Het
Tgtp2 A G 11: 48,950,083 (GRCm39) M163T probably benign Het
Tiam1 G T 16: 89,662,280 (GRCm39) Q613K possibly damaging Het
Vsig10l T A 7: 43,114,247 (GRCm39) S190T probably damaging Het
Vwa3b A G 1: 37,154,752 (GRCm39) Y512C probably damaging Het
Wdfy3 T A 5: 102,067,312 (GRCm39) N1207Y probably damaging Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Wdr81 A C 11: 75,341,722 (GRCm39) S1182A possibly damaging Het
Zfp458 A T 13: 67,405,256 (GRCm39) C391* probably null Het
Zfp638 A G 6: 83,953,396 (GRCm39) E1167G probably damaging Het
Zfp763 T A 17: 33,238,569 (GRCm39) D192V probably benign Het
Zfp853 T G 5: 143,274,624 (GRCm39) Q332P unknown Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8,049,088 (GRCm39) missense probably benign 0.07
IGL01121:Wdr70 APN 15 7,902,655 (GRCm39) missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8,108,747 (GRCm39) missense probably benign 0.33
IGL01801:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01815:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01929:Wdr70 APN 15 7,950,115 (GRCm39) splice site probably null
IGL02150:Wdr70 APN 15 8,112,030 (GRCm39) missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8,075,965 (GRCm39) missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7,913,783 (GRCm39) nonsense probably null
IGL02800:Wdr70 APN 15 8,111,980 (GRCm39) missense probably benign 0.25
IGL02829:Wdr70 APN 15 8,006,463 (GRCm39) missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7,913,787 (GRCm39) missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7,913,821 (GRCm39) missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8,065,352 (GRCm39) missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0462:Wdr70 UTSW 15 8,108,645 (GRCm39) missense probably benign 0.00
R0539:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8,065,325 (GRCm39) missense probably benign 0.01
R1812:Wdr70 UTSW 15 8,108,663 (GRCm39) missense probably benign 0.00
R1863:Wdr70 UTSW 15 7,950,054 (GRCm39) missense probably benign 0.25
R1913:Wdr70 UTSW 15 7,913,891 (GRCm39) missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7,916,840 (GRCm39) nonsense probably null
R4013:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4015:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4017:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4111:Wdr70 UTSW 15 8,006,472 (GRCm39) missense probably benign 0.32
R5241:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R5277:Wdr70 UTSW 15 8,006,465 (GRCm39) nonsense probably null
R5306:Wdr70 UTSW 15 7,953,754 (GRCm39) missense probably benign 0.04
R5586:Wdr70 UTSW 15 7,913,769 (GRCm39) missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7,916,900 (GRCm39) splice site probably null
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8,108,638 (GRCm39) splice site probably null
R6139:Wdr70 UTSW 15 8,108,735 (GRCm39) missense probably benign 0.04
R6400:Wdr70 UTSW 15 8,072,322 (GRCm39) missense probably benign 0.32
R6456:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8,108,821 (GRCm39) missense unknown
R7036:Wdr70 UTSW 15 7,913,855 (GRCm39) missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7,913,877 (GRCm39) missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7,953,725 (GRCm39) missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7,951,562 (GRCm39) missense probably benign 0.23
R7572:Wdr70 UTSW 15 8,065,327 (GRCm39) missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R7886:Wdr70 UTSW 15 8,108,733 (GRCm39) missense probably benign 0.02
R8103:Wdr70 UTSW 15 8,006,612 (GRCm39) missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7,916,851 (GRCm39) missense probably benign 0.03
R8252:Wdr70 UTSW 15 8,072,337 (GRCm39) splice site probably benign
R8869:Wdr70 UTSW 15 8,123,210 (GRCm39) missense probably benign 0.02
R9203:Wdr70 UTSW 15 7,902,684 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGATGCAAGGTAACACTAAAGC -3'
(R):5'- TCCGGAAAGTAATTGCTGGGAG -3'

Sequencing Primer
(F):5'- TCTTGCAGAGGACCCAAGTTC -3'
(R):5'- AGTAATTGCTGGGAGGATAACTC -3'
Posted On 2016-09-01