Incidental Mutation 'R5426:Kalrn'
ID426919
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 042992-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34262653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 644 (V644D)
Ref Sequence ENSEMBL: ENSMUSP00000087084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: V626D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: V626D

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089655
AA Change: V644D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: V644D

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114947
AA Change: V3D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: V3D

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114949
AA Change: V3D
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: V3D

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114953
AA Change: V3D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: V3D

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114954
AA Change: V3D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: V3D

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114960
AA Change: V644D
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: V644D

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137216
Predicted Effect unknown
Transcript: ENSMUST00000142817
AA Change: V621D
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: V621D

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151491
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Meta Mutation Damage Score 0.5420 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
C87499 T A 4: 88,629,410 probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dnah7b T C 1: 46,242,206 M2809T possibly damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
Dsg4 T C 18: 20,458,484 Y427H probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sept7 T A 9: 25,286,690 I100N possibly damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Slco4a1 C A 2: 180,471,235 A420D possibly damaging Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGAAAGGCTACATTTGGTACTGAC -3'
(R):5'- AAGGCACGAAGCTTGTTCCC -3'

Sequencing Primer
(F):5'- GGTACTGACCTAAATGCAGGCTTC -3'
(R):5'- GTTCCCTGGCTGCAAGTTGAC -3'
Posted On2016-09-01