Incidental Mutation 'R5426:Ildr1'
ID 426920
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
MMRRC Submission 042992-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5426 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36514340-36547166 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36529981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 123 (I123F)
Ref Sequence ENSEMBL: ENSMUSP00000112539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect probably damaging
Transcript: ENSMUST00000023617
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: I123F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089618
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: I123F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119464
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: I123F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153802
Meta Mutation Damage Score 0.6919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,633 (GRCm39) H122L probably damaging Het
9330182O14Rik G A 15: 40,011,932 (GRCm39) M90I unknown Het
9330182O14Rik G A 15: 40,011,933 (GRCm39) D91N unknown Het
Abca13 T A 11: 9,240,722 (GRCm39) S862T probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgb C A 10: 10,226,004 (GRCm39) A1405S probably benign Het
Adpgk T A 9: 59,204,832 (GRCm39) V86E probably damaging Het
Agfg2 G C 5: 137,666,020 (GRCm39) P80A probably damaging Het
Akap11 G A 14: 78,736,304 (GRCm39) Q1829* probably null Het
Aldh1l1 G A 6: 90,536,281 (GRCm39) R62Q probably benign Het
Amd1 G T 10: 40,166,183 (GRCm39) D265E probably damaging Het
Aox4 A T 1: 58,259,253 (GRCm39) Q106L probably damaging Het
Arap2 A T 5: 62,800,159 (GRCm39) N1289K probably benign Het
Arhgef12 T C 9: 42,897,880 (GRCm39) S874G probably damaging Het
Ccdc166 T C 15: 75,853,945 (GRCm39) Q45R possibly damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Cdk14 A G 5: 4,938,975 (GRCm39) S388P possibly damaging Het
Chgb A T 2: 132,635,453 (GRCm39) Q465L possibly damaging Het
Commd9 T A 2: 101,729,220 (GRCm39) W109R probably damaging Het
Cspg4b G A 13: 113,505,587 (GRCm39) V2239I probably benign Het
Cyp2b9 T C 7: 25,887,080 (GRCm39) V163A probably benign Het
Dcpp2 T A 17: 24,118,287 (GRCm39) H27Q possibly damaging Het
Ddn T A 15: 98,704,347 (GRCm39) E315V possibly damaging Het
Defb29 C A 2: 152,380,868 (GRCm39) C47F probably damaging Het
Dnah7b T C 1: 46,281,366 (GRCm39) M2809T possibly damaging Het
Dock4 A T 12: 40,795,744 (GRCm39) I854F probably damaging Het
Dsg4 T C 18: 20,591,541 (GRCm39) Y427H probably damaging Het
E130114P18Rik C T 4: 97,578,907 (GRCm39) A23T unknown Het
Flacc1 T A 1: 58,706,045 (GRCm39) K275* probably null Het
Gemin5 A G 11: 58,016,113 (GRCm39) S1297P probably benign Het
Gm10309 A C 17: 86,806,161 (GRCm39) probably benign Het
Gpatch11 T A 17: 79,148,663 (GRCm39) S155R possibly damaging Het
Grin2b C A 6: 135,709,366 (GRCm39) Q1393H probably damaging Het
Heatr5b C T 17: 79,081,142 (GRCm39) C1370Y probably damaging Het
Hmcn2 C T 2: 31,226,556 (GRCm39) T177I possibly damaging Het
Kalrn A T 16: 34,083,023 (GRCm39) V644D probably damaging Het
Kifap3 A G 1: 163,607,440 (GRCm39) M1V probably null Het
Klhl11 A G 11: 100,354,942 (GRCm39) L293P probably damaging Het
Klrc3 G A 6: 129,618,513 (GRCm39) S98L probably benign Het
Lrrc37 A T 11: 103,511,586 (GRCm39) H127Q unknown Het
Med12l G A 3: 59,156,143 (GRCm39) M1220I probably damaging Het
Ms4a7 C T 19: 11,303,166 (GRCm39) probably null Het
Mybpc2 A G 7: 44,159,253 (GRCm39) V599A probably benign Het
Naalad2 T C 9: 18,258,815 (GRCm39) N487D probably benign Het
Nat8f7 T G 6: 85,684,805 (GRCm39) S12R probably benign Het
Nefm T A 14: 68,357,515 (GRCm39) probably benign Het
Nlrp5 T C 7: 23,117,626 (GRCm39) V450A probably damaging Het
Nps G A 7: 134,870,376 (GRCm39) probably null Het
Or13c7d A G 4: 43,770,168 (GRCm39) I281T probably benign Het
Or2ag16 C A 7: 106,351,773 (GRCm39) S274I probably benign Het
Or4a74 T C 2: 89,440,083 (GRCm39) Y121C probably damaging Het
Or4b13 T A 2: 90,082,955 (GRCm39) K126* probably null Het
Or5e1 T C 7: 108,354,924 (GRCm39) L287P possibly damaging Het
Or5h24 G T 16: 58,918,665 (GRCm39) P230Q possibly damaging Het
Or5p67 T C 7: 107,922,017 (GRCm39) N289D probably damaging Het
Oxct2a C A 4: 123,216,506 (GRCm39) G292W possibly damaging Het
Pramel32 T A 4: 88,547,647 (GRCm39) probably benign Het
Prr27 T C 5: 87,998,744 (GRCm39) probably benign Het
Ptx3 T C 3: 66,128,143 (GRCm39) M68T probably damaging Het
Rufy1 A G 11: 50,312,561 (GRCm39) L131S probably damaging Het
Septin7 T A 9: 25,197,986 (GRCm39) I100N possibly damaging Het
Sgms2 T C 3: 131,135,446 (GRCm39) I143V probably benign Het
Slc25a34 A G 4: 141,350,877 (GRCm39) V44A probably damaging Het
Slc28a3 T A 13: 58,710,968 (GRCm39) D518V probably damaging Het
Slc6a7 C T 18: 61,136,308 (GRCm39) probably null Het
Slco4a1 C A 2: 180,113,028 (GRCm39) A420D possibly damaging Het
Smap1 T C 1: 23,888,471 (GRCm39) T180A probably benign Het
Specc1l T C 10: 75,103,384 (GRCm39) S920P probably benign Het
Tgtp2 A G 11: 48,950,083 (GRCm39) M163T probably benign Het
Tiam1 G T 16: 89,662,280 (GRCm39) Q613K possibly damaging Het
Vsig10l T A 7: 43,114,247 (GRCm39) S190T probably damaging Het
Vwa3b A G 1: 37,154,752 (GRCm39) Y512C probably damaging Het
Wdfy3 T A 5: 102,067,312 (GRCm39) N1207Y probably damaging Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Wdr70 A G 15: 7,951,586 (GRCm39) L417S possibly damaging Het
Wdr81 A C 11: 75,341,722 (GRCm39) S1182A possibly damaging Het
Zfp458 A T 13: 67,405,256 (GRCm39) C391* probably null Het
Zfp638 A G 6: 83,953,396 (GRCm39) E1167G probably damaging Het
Zfp763 T A 17: 33,238,569 (GRCm39) D192V probably benign Het
Zfp853 T G 5: 143,274,624 (GRCm39) Q332P unknown Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36,542,712 (GRCm39) missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36,536,526 (GRCm39) missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36,529,839 (GRCm39) critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36,528,681 (GRCm39) missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36,528,698 (GRCm39) missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36,536,568 (GRCm39) missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36,545,903 (GRCm39) missense probably damaging 0.97
R2110:Ildr1 UTSW 16 36,542,341 (GRCm39) missense probably damaging 1.00
R2111:Ildr1 UTSW 16 36,542,341 (GRCm39) missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36,542,383 (GRCm39) missense probably benign 0.00
R4798:Ildr1 UTSW 16 36,542,917 (GRCm39) missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36,528,660 (GRCm39) missense probably benign 0.10
R5014:Ildr1 UTSW 16 36,541,921 (GRCm39) missense probably damaging 0.98
R5957:Ildr1 UTSW 16 36,545,896 (GRCm39) makesense probably null
R7058:Ildr1 UTSW 16 36,542,730 (GRCm39) missense probably benign 0.01
R7646:Ildr1 UTSW 16 36,542,281 (GRCm39) missense possibly damaging 0.78
R8245:Ildr1 UTSW 16 36,529,883 (GRCm39) missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36,542,721 (GRCm39) missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36,542,720 (GRCm39) nonsense probably null
R8748:Ildr1 UTSW 16 36,542,734 (GRCm39) missense probably benign 0.18
R8791:Ildr1 UTSW 16 36,528,762 (GRCm39) missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36,535,910 (GRCm39) missense probably damaging 1.00
R9108:Ildr1 UTSW 16 36,535,919 (GRCm39) missense probably benign 0.13
R9252:Ildr1 UTSW 16 36,536,574 (GRCm39) missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36,542,721 (GRCm39) missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36,529,862 (GRCm39) missense probably damaging 1.00
R9642:Ildr1 UTSW 16 36,536,490 (GRCm39) missense probably damaging 1.00
R9681:Ildr1 UTSW 16 36,528,749 (GRCm39) missense probably damaging 1.00
R9707:Ildr1 UTSW 16 36,529,892 (GRCm39) missense probably damaging 1.00
R9777:Ildr1 UTSW 16 36,528,659 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCAGATCCTACACCTGACTCG -3'
(R):5'- CCAGGGAAGTGGCTTTAGATG -3'

Sequencing Primer
(F):5'- TGACTCGCGGACTCTGAATG -3'
(R):5'- GGCTTTAGATGGTGGAAAACATTC -3'
Posted On 2016-09-01