Mutagenetix > Incidental Mutation

Incidental Mutation 'R5426:Ildr1'

426920

Institutional Source

Beutler Lab

Gene Symbol

Ildr1

Ensembl Gene

ENSMUSG00000022900

Gene Name

immunoglobulin-like domain containing receptor 1

Synonyms

MMRRC Submission

042992-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36693978-36726804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36709619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 123 (I123F)

Ref Sequence

ENSEMBL: ENSMUSP00000112539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]

AlphaFold

Q8CBR1

Predicted Effect

probably damaging
Transcript: ENSMUST00000023617
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: I123F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	213	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000089618
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: I123F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	2.8e-27	PFAM
low complexity region	380	428	N/A	INTRINSIC
low complexity region	437	445	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119464
AA Change: I123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: I123F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153802

Meta Mutation Damage Score

0.6919

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,003	H122L	probably damaging	Het
9330182O14Rik	G	A	15: 40,148,536	M90I	unknown	Het
9330182O14Rik	G	A	15: 40,148,537	D91N	unknown	Het
Abca13	T	A	11: 9,290,722	S862T	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgb	C	A	10: 10,350,260	A1405S	probably benign	Het
Adpgk	T	A	9: 59,297,549	V86E	probably damaging	Het
Agfg2	G	C	5: 137,667,758	P80A	probably damaging	Het
Akap11	G	A	14: 78,498,864	Q1829*	probably null	Het
Aldh1l1	G	A	6: 90,559,299	R62Q	probably benign	Het
Als2cr12	T	A	1: 58,666,886	K275*	probably null	Het
Amd1	G	T	10: 40,290,187	D265E	probably damaging	Het
Aox4	A	T	1: 58,220,094	Q106L	probably damaging	Het
Arap2	A	T	5: 62,642,816	N1289K	probably benign	Het
Arhgef12	T	C	9: 42,986,584	S874G	probably damaging	Het
BC067074	G	A	13: 113,369,053	V2239I	probably benign	Het
C87499	T	A	4: 88,629,410		probably benign	Het
Ccdc166	T	C	15: 75,982,096	Q45R	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk14	A	G	5: 4,888,975	S388P	possibly damaging	Het
Chgb	A	T	2: 132,793,533	Q465L	possibly damaging	Het
Commd9	T	A	2: 101,898,875	W109R	probably damaging	Het
Cyp2b9	T	C	7: 26,187,655	V163A	probably benign	Het
Dcpp2	T	A	17: 23,899,313	H27Q	possibly damaging	Het
Ddn	T	A	15: 98,806,466	E315V	possibly damaging	Het
Defb29	C	A	2: 152,538,948	C47F	probably damaging	Het
Dnah7b	T	C	1: 46,242,206	M2809T	possibly damaging	Het
Dock4	A	T	12: 40,745,745	I854F	probably damaging	Het
Dsg4	T	C	18: 20,458,484	Y427H	probably damaging	Het
E130114P18Rik	C	T	4: 97,690,670	A23T	unknown	Het
Gemin5	A	G	11: 58,125,287	S1297P	probably benign	Het
Gm10309	A	C	17: 86,498,733		probably benign	Het
Gm884	A	T	11: 103,620,760	H127Q	unknown	Het
Gpatch11	T	A	17: 78,841,234	S155R	possibly damaging	Het
Grin2b	C	A	6: 135,732,368	Q1393H	probably damaging	Het
Heatr5b	C	T	17: 78,773,713	C1370Y	probably damaging	Het
Hmcn2	C	T	2: 31,336,544	T177I	possibly damaging	Het
Kalrn	A	T	16: 34,262,653	V644D	probably damaging	Het
Kifap3	A	G	1: 163,779,871	M1V	probably null	Het
Klhl11	A	G	11: 100,464,116	L293P	probably damaging	Het
Klrc3	G	A	6: 129,641,550	S98L	probably benign	Het
Med12l	G	A	3: 59,248,722	M1220I	probably damaging	Het
Ms4a7	C	T	19: 11,325,802		probably null	Het
Mybpc2	A	G	7: 44,509,829	V599A	probably benign	Het
Naalad2	T	C	9: 18,347,519	N487D	probably benign	Het
Nat8f7	T	G	6: 85,707,823	S12R	probably benign	Het
Nefm	T	A	14: 68,120,066		probably benign	Het
Nlrp5	T	C	7: 23,418,201	V450A	probably damaging	Het
Nps	G	A	7: 135,268,647		probably null	Het
Olfr1247	T	C	2: 89,609,739	Y121C	probably damaging	Het
Olfr142	T	A	2: 90,252,611	K126*	probably null	Het
Olfr159	A	G	4: 43,770,168	I281T	probably benign	Het
Olfr192	G	T	16: 59,098,302	P230Q	possibly damaging	Het
Olfr492	T	C	7: 108,322,810	N289D	probably damaging	Het
Olfr513	T	C	7: 108,755,717	L287P	possibly damaging	Het
Olfr698	C	A	7: 106,752,566	S274I	probably benign	Het
Oxct2a	C	A	4: 123,322,713	G292W	possibly damaging	Het
Prr27	T	C	5: 87,850,885		probably benign	Het
Ptx3	T	C	3: 66,220,722	M68T	probably damaging	Het
Rufy1	A	G	11: 50,421,734	L131S	probably damaging	Het
Sept7	T	A	9: 25,286,690	I100N	possibly damaging	Het
Sgms2	T	C	3: 131,341,797	I143V	probably benign	Het
Slc25a34	A	G	4: 141,623,566	V44A	probably damaging	Het
Slc28a3	T	A	13: 58,563,154	D518V	probably damaging	Het
Slc6a7	C	T	18: 61,003,236		probably null	Het
Slco4a1	C	A	2: 180,471,235	A420D	possibly damaging	Het
Smap1	T	C	1: 23,849,390	T180A	probably benign	Het
Specc1l	T	C	10: 75,267,550	S920P	probably benign	Het
Tgtp2	A	G	11: 49,059,256	M163T	probably benign	Het
Tiam1	G	T	16: 89,865,392	Q613K	possibly damaging	Het
Vsig10l	T	A	7: 43,464,823	S190T	probably damaging	Het
Vwa3b	A	G	1: 37,115,671	Y512C	probably damaging	Het
Wdfy3	T	A	5: 101,919,446	N1207Y	probably damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Wdr70	A	G	15: 7,922,105	L417S	possibly damaging	Het
Wdr81	A	C	11: 75,450,896	S1182A	possibly damaging	Het
Zfp458	A	T	13: 67,257,192	C391*	probably null	Het
Zfp638	A	G	6: 83,976,414	E1167G	probably damaging	Het
Zfp763	T	A	17: 33,019,595	D192V	probably benign	Het
Zfp853	T	G	5: 143,288,869	Q332P	unknown	Het

Other mutations in Ildr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02501:Ildr1	APN	16	36722350	missense	probably damaging	1.00
IGL02505:Ildr1	APN	16	36716164	missense	probably damaging	1.00
R0295:Ildr1	UTSW	16	36709477	critical splice acceptor site	probably null
R1649:Ildr1	UTSW	16	36708319	missense	probably damaging	1.00
R1728:Ildr1	UTSW	16	36708336	missense	possibly damaging	0.80
R1990:Ildr1	UTSW	16	36716206	missense	probably damaging	0.99
R2020:Ildr1	UTSW	16	36725541	missense	probably damaging	0.97
R2110:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R2111:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R4755:Ildr1	UTSW	16	36722021	missense	probably benign	0.00
R4798:Ildr1	UTSW	16	36722555	missense	possibly damaging	0.66
R4973:Ildr1	UTSW	16	36708298	missense	probably benign	0.10
R5014:Ildr1	UTSW	16	36721559	missense	probably damaging	0.98
R5957:Ildr1	UTSW	16	36725534	makesense	probably null
R7058:Ildr1	UTSW	16	36722368	missense	probably benign	0.01
R7646:Ildr1	UTSW	16	36721919	missense	possibly damaging	0.78
R8245:Ildr1	UTSW	16	36709521	missense	probably damaging	1.00
R8392:Ildr1	UTSW	16	36722358	nonsense	probably null
R8392:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R8748:Ildr1	UTSW	16	36722372	missense	probably benign	0.18
R8791:Ildr1	UTSW	16	36708400	missense	probably damaging	0.96
R8854:Ildr1	UTSW	16	36715548	missense	probably damaging	1.00
R9108:Ildr1	UTSW	16	36715557	missense	probably benign	0.13
R9252:Ildr1	UTSW	16	36716212	missense	probably damaging	1.00
R9372:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R9434:Ildr1	UTSW	16	36709500	missense	probably damaging	1.00
R9642:Ildr1	UTSW	16	36716128	missense	probably damaging	1.00
R9681:Ildr1	UTSW	16	36708387	missense	probably damaging	1.00
R9707:Ildr1	UTSW	16	36709530	missense	probably damaging	1.00
R9777:Ildr1	UTSW	16	36708297	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCAGATCCTACACCTGACTCG -3'
(R):5'- CCAGGGAAGTGGCTTTAGATG -3'

Sequencing Primer
(F):5'- TGACTCGCGGACTCTGAATG -3'
(R):5'- GGCTTTAGATGGTGGAAAACATTC -3'

Posted On

2016-09-01