Incidental Mutation 'R5427:Gm38394'
ID426934
Institutional Source Beutler Lab
Gene Symbol Gm38394
Ensembl Gene ENSMUSG00000094410
Gene Namepredicted gene, 38394
Synonyms
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133619940-133661318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133657595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 668 (V668A)
Ref Sequence ENSEMBL: ENSMUSP00000140892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000190574] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195067] [ENSMUST00000195424]
Predicted Effect probably benign
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179598
AA Change: V668A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410
AA Change: V668A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186476
AA Change: V668A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410
AA Change: V668A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190574
AA Change: V668A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140892
Gene: ENSMUSG00000102049
AA Change: V668A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191705
Predicted Effect probably benign
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192775
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Meta Mutation Damage Score 0.3957 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Gm38394
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0385:Gm38394 UTSW 1 133656784 missense probably damaging 0.99
R0417:Gm38394 UTSW 1 133658538 missense probably benign
R0526:Gm38394 UTSW 1 133658734 missense probably damaging 0.99
R0576:Gm38394 UTSW 1 133657838 missense probably benign 0.37
R1164:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1187:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1415:Gm38394 UTSW 1 133657818 missense possibly damaging 0.80
R1997:Gm38394 UTSW 1 133656713 missense probably damaging 1.00
R2186:Gm38394 UTSW 1 133658079 missense probably damaging 1.00
R2875:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2876:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2975:Gm38394 UTSW 1 133658237 missense probably damaging 0.99
R4573:Gm38394 UTSW 1 133659389 missense probably benign 0.00
R4631:Gm38394 UTSW 1 133658744 missense probably damaging 1.00
R4671:Gm38394 UTSW 1 133657040 missense probably benign
R4976:Gm38394 UTSW 1 133658094 missense probably benign 0.27
R5048:Gm38394 UTSW 1 133658724 missense probably damaging 0.99
R5318:Gm38394 UTSW 1 133658115 missense possibly damaging 0.86
R5400:Gm38394 UTSW 1 133658141 missense probably damaging 1.00
R6530:Gm38394 UTSW 1 133659201 missense probably damaging 1.00
R7511:Gm38394 UTSW 1 133659243 missense probably benign 0.30
Z1177:Gm38394 UTSW 1 133659116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAGTCTCTGCAGGG -3'
(R):5'- GCATCTTCTCCCAGTAATGGTG -3'

Sequencing Primer
(F):5'- TCTCTGAGTCTCTGCAGGGAAAAG -3'
(R):5'- CAATCAAAGGTGGTGGCTTTACCC -3'
Posted On2016-09-01