Incidental Mutation 'R5427:Fign'
ID426936
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Namefidgetin
Synonyms
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location63971507-64098038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63978998 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 643 (Y643H)
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126042
Predicted Effect probably damaging
Transcript: ENSMUST00000131615
AA Change: Y643H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324
AA Change: Y643H

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153538
Meta Mutation Damage Score 0.1839 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Fign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Fign APN 2 63979010 missense probably damaging 0.99
IGL01149:Fign APN 2 63979760 missense possibly damaging 0.92
IGL01328:Fign APN 2 63978872 missense probably damaging 0.97
IGL01448:Fign APN 2 63979688 missense probably damaging 0.97
IGL01680:Fign APN 2 63978644 utr 3 prime probably benign
IGL01989:Fign APN 2 63980450 missense probably benign
IGL02010:Fign APN 2 63980400 missense probably damaging 0.98
IGL02092:Fign APN 2 63980583 missense possibly damaging 0.95
IGL02252:Fign APN 2 63980639 missense probably benign 0.14
IGL02455:Fign APN 2 63980497 missense probably benign 0.22
IGL02541:Fign APN 2 63979537 missense probably benign 0.38
IGL03109:Fign APN 2 63980662 missense possibly damaging 0.83
R0534:Fign UTSW 2 63980791 missense probably damaging 0.96
R0630:Fign UTSW 2 63980141 missense possibly damaging 0.86
R1678:Fign UTSW 2 63980374 missense probably damaging 0.99
R2512:Fign UTSW 2 63979799 missense probably benign 0.03
R3125:Fign UTSW 2 63978700 missense possibly damaging 0.94
R4679:Fign UTSW 2 63979261 missense probably damaging 1.00
R4735:Fign UTSW 2 63980438 missense probably damaging 1.00
R4753:Fign UTSW 2 63979019 missense probably benign 0.04
R5071:Fign UTSW 2 63979693 nonsense probably null
R5072:Fign UTSW 2 63979693 nonsense probably null
R5073:Fign UTSW 2 63979693 nonsense probably null
R5074:Fign UTSW 2 63979693 nonsense probably null
R5344:Fign UTSW 2 63979225 missense probably benign 0.01
R5922:Fign UTSW 2 63979060 missense probably damaging 0.99
R6115:Fign UTSW 2 63979310 missense probably benign 0.22
R6373:Fign UTSW 2 63979645 missense probably benign 0.06
R6542:Fign UTSW 2 63980295 missense possibly damaging 0.53
R6637:Fign UTSW 2 64027908 intron probably benign
R6858:Fign UTSW 2 63979813 missense probably benign 0.02
R7188:Fign UTSW 2 63979606 missense possibly damaging 0.95
R7309:Fign UTSW 2 63979957 missense possibly damaging 0.77
R7429:Fign UTSW 2 63979060 missense probably damaging 0.99
R7430:Fign UTSW 2 63979060 missense probably damaging 0.99
R7608:Fign UTSW 2 63978719 missense possibly damaging 0.75
R7642:Fign UTSW 2 63980572 missense probably benign 0.16
R7782:Fign UTSW 2 63979162 missense probably damaging 1.00
X0028:Fign UTSW 2 63980851 missense probably damaging 1.00
Z1088:Fign UTSW 2 64096902 missense probably benign 0.01
Z1177:Fign UTSW 2 63979385 missense probably damaging 1.00
Z1177:Fign UTSW 2 63979690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCCTGACACAAATGAGCC -3'
(R):5'- GCGGAGAAAATCATCCACGC -3'

Sequencing Primer
(F):5'- ATGAGCCACGTCTAGTCCAG -3'
(R):5'- GGAGAAAATCATCCACGCCTCTTTTC -3'
Posted On2016-09-01