Incidental Mutation 'R5427:Kcnk3'
ID426944
Institutional Source Beutler Lab
Gene Symbol Kcnk3
Ensembl Gene ENSMUSG00000049265
Gene Namepotassium channel, subfamily K, member 3
SynonymscTBAK-1, Task-1
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30588170-30625271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30622295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 230 (T230A)
Ref Sequence ENSEMBL: ENSMUSP00000098987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066295
AA Change: T230A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: T230A

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:Ion_trans_2 58 134 2.9e-20 PFAM
Pfam:Ion_trans_2 165 248 1.4e-21 PFAM
low complexity region 272 286 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197428
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Kcnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Kcnk3 APN 5 30622383 missense probably damaging 0.99
IGL02719:Kcnk3 APN 5 30621980 missense probably damaging 1.00
PIT4802001:Kcnk3 UTSW 5 30622368 missense probably damaging 1.00
R0288:Kcnk3 UTSW 5 30588420 missense probably benign
R0834:Kcnk3 UTSW 5 30622635 missense probably damaging 1.00
R1740:Kcnk3 UTSW 5 30621977 missense possibly damaging 0.95
R2656:Kcnk3 UTSW 5 30622671 missense possibly damaging 0.55
R2923:Kcnk3 UTSW 5 30622070 missense probably damaging 1.00
R3740:Kcnk3 UTSW 5 30621930 missense possibly damaging 0.93
R4584:Kcnk3 UTSW 5 30588386 missense probably damaging 0.99
R5010:Kcnk3 UTSW 5 30622805 missense possibly damaging 0.79
R5070:Kcnk3 UTSW 5 30622386 missense possibly damaging 0.77
R5669:Kcnk3 UTSW 5 30622349 missense probably damaging 0.99
R5956:Kcnk3 UTSW 5 30588510 missense probably damaging 1.00
R5982:Kcnk3 UTSW 5 30622670 missense probably benign 0.18
R5986:Kcnk3 UTSW 5 30588378 missense possibly damaging 0.68
R6318:Kcnk3 UTSW 5 30622586 missense probably damaging 0.98
R6860:Kcnk3 UTSW 5 30622053 missense possibly damaging 0.86
R6919:Kcnk3 UTSW 5 30622400 missense probably benign 0.00
R7350:Kcnk3 UTSW 5 30621966 missense probably damaging 1.00
R7418:Kcnk3 UTSW 5 30622331 missense possibly damaging 0.57
R7502:Kcnk3 UTSW 5 30622718 missense possibly damaging 0.85
Z1177:Kcnk3 UTSW 5 30588274 start gained probably benign
Z1177:Kcnk3 UTSW 5 30622493 missense probably benign
Z1177:Kcnk3 UTSW 5 30622704 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CATGGTGCTCATCGGTTTCG -3'
(R):5'- TCTTGTACCAGAGGCACGAG -3'

Sequencing Primer
(F):5'- TCGTGTCGTGCATCAGC -3'
(R):5'- AGCACCTCGGCATAGACGTTG -3'
Posted On2016-09-01