Incidental Mutation 'R5427:Anapc15'
ID426955
Institutional Source Beutler Lab
Gene Symbol Anapc15
Ensembl Gene ENSMUSG00000030649
Gene Nameanaphase prompoting complex C subunit 15
Synonyms
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101863715-101901849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101898603 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 68 (P68L)
Ref Sequence ENSEMBL: ENSMUSP00000095839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000106973] [ENSMUST00000106978] [ENSMUST00000143835] [ENSMUST00000144207] [ENSMUST00000178851] [ENSMUST00000209334] [ENSMUST00000210984]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably damaging
Transcript: ENSMUST00000035395
AA Change: P77L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649
AA Change: P77L

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098237
AA Change: P68L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649
AA Change: P68L

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106969
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106970
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106973
AA Change: P57L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649
AA Change: P57L

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106978
AA Change: P68L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649
AA Change: P68L

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect possibly damaging
Transcript: ENSMUST00000143835
AA Change: P68L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649
AA Change: P68L

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144207
AA Change: P68L

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649
AA Change: P68L

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably damaging
Transcript: ENSMUST00000178851
AA Change: P68L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649
AA Change: P68L

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect possibly damaging
Transcript: ENSMUST00000210984
AA Change: P68L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Anapc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0426:Anapc15 UTSW 7 101898033 missense probably benign 0.10
R0513:Anapc15 UTSW 7 101898540 splice site probably benign
R4625:Anapc15 UTSW 7 101901032 unclassified probably benign
R4846:Anapc15 UTSW 7 101897767 missense probably benign 0.05
R5318:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5334:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5337:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5396:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5398:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5399:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R7719:Anapc15 UTSW 7 101901029 missense unknown
R7903:Anapc15 UTSW 7 101897986 missense probably benign 0.07
R7986:Anapc15 UTSW 7 101897986 missense probably benign 0.07
Z1177:Anapc15 UTSW 7 101901039 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGCATCTTCCTGAGAACTGG -3'
(R):5'- AACCTTGCCTGCCTTGAGTC -3'

Sequencing Primer
(F):5'- GGGGGAGAAGCTTTGTTTCAAC -3'
(R):5'- TGCTGCATGACCTGAAGG -3'
Posted On2016-09-01