Incidental Mutation 'R5427:Adcy7'
ID426963
Institutional Source Beutler Lab
Gene Symbol Adcy7
Ensembl Gene ENSMUSG00000031659
Gene Nameadenylate cyclase 7
Synonyms
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88272403-88329962 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 88326201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034085] [ENSMUST00000098521] [ENSMUST00000168545] [ENSMUST00000169037] [ENSMUST00000171456]
Predicted Effect probably benign
Transcript: ENSMUST00000034085
SMART Domains Protein: ENSMUSP00000034085
Gene: ENSMUSG00000031660

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
low complexity region 76 96 N/A INTRINSIC
BROMO 129 237 9.72e-38 SMART
Pfam:DUF3512 287 534 2.4e-93 PFAM
coiled coil region 535 564 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098521
SMART Domains Protein: ENSMUSP00000096122
Gene: ENSMUSG00000031659

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131748
Predicted Effect probably null
Transcript: ENSMUST00000168545
SMART Domains Protein: ENSMUSP00000129252
Gene: ENSMUSG00000031659

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169037
SMART Domains Protein: ENSMUSP00000130594
Gene: ENSMUSG00000031659

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171456
SMART Domains Protein: ENSMUSP00000132528
Gene: ENSMUSG00000031659

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 1.2e-35 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210688
Meta Mutation Damage Score 0.9586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. Several transcript variants have been observed for this gene, but the full-length natures of only two have been determined so far. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display some degree of pre- or postnatal lethality. Surviving adults for one allele appear to be normal. Heterozygous females for one allele display decreased depression related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Adcy7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Adcy7 APN 8 88318790 splice site probably benign
IGL01434:Adcy7 APN 8 88324844 missense probably damaging 1.00
IGL01784:Adcy7 APN 8 88314123 missense probably damaging 1.00
IGL02506:Adcy7 APN 8 88317943 missense probably damaging 1.00
IGL03184:Adcy7 APN 8 88308643 missense probably benign 0.00
IGL03406:Adcy7 APN 8 88318319 nonsense probably null
PIT4283001:Adcy7 UTSW 8 88315492 missense probably damaging 1.00
PIT4453001:Adcy7 UTSW 8 88323636 missense probably benign 0.07
R0265:Adcy7 UTSW 8 88324763 missense probably damaging 0.96
R0963:Adcy7 UTSW 8 88312265 missense probably damaging 1.00
R0990:Adcy7 UTSW 8 88325452 missense possibly damaging 0.57
R1055:Adcy7 UTSW 8 88318057 splice site probably benign
R1494:Adcy7 UTSW 8 88320207 missense probably benign 0.00
R1764:Adcy7 UTSW 8 88308840 missense probably benign 0.00
R2062:Adcy7 UTSW 8 88312274 missense probably damaging 1.00
R2090:Adcy7 UTSW 8 88315857 missense probably damaging 0.98
R2201:Adcy7 UTSW 8 88317978 missense probably damaging 1.00
R2413:Adcy7 UTSW 8 88309818 missense probably benign 0.20
R2849:Adcy7 UTSW 8 88327393 missense probably benign 0.38
R4020:Adcy7 UTSW 8 88308734 missense probably benign 0.00
R4086:Adcy7 UTSW 8 88315786 missense probably benign 0.01
R4679:Adcy7 UTSW 8 88317937 missense probably benign 0.01
R5069:Adcy7 UTSW 8 88327697 missense probably damaging 1.00
R5253:Adcy7 UTSW 8 88314114 missense probably damaging 1.00
R5286:Adcy7 UTSW 8 88324859 missense probably damaging 1.00
R5457:Adcy7 UTSW 8 88311021 missense probably damaging 1.00
R5689:Adcy7 UTSW 8 88324784 missense probably benign 0.00
R5907:Adcy7 UTSW 8 88312228 missense possibly damaging 0.76
R5909:Adcy7 UTSW 8 88325496 missense probably damaging 1.00
R5997:Adcy7 UTSW 8 88326392 missense probably benign 0.41
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6133:Adcy7 UTSW 8 88325439 missense possibly damaging 0.84
R6190:Adcy7 UTSW 8 88325730 intron probably null
R6213:Adcy7 UTSW 8 88314137 missense probably damaging 1.00
R6287:Adcy7 UTSW 8 88311108 missense possibly damaging 0.80
R6502:Adcy7 UTSW 8 88325479 missense probably damaging 1.00
R6989:Adcy7 UTSW 8 88308786 missense probably benign
R7042:Adcy7 UTSW 8 88315750 missense probably damaging 0.99
R7829:Adcy7 UTSW 8 88315759 missense probably damaging 1.00
R8067:Adcy7 UTSW 8 88311069 missense probably damaging 1.00
X0067:Adcy7 UTSW 8 88324600 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATGAACTCGGATGGACAAG -3'
(R):5'- ATAACCTACTCCATGCAGCCTTG -3'

Sequencing Primer
(F):5'- CGTGCATGCCATGTGTCTGTAC -3'
(R):5'- ACTCCATGCAGCCTTGACTGAG -3'
Posted On2016-09-01