Mutagenetix > Incidental Mutations

Incidental Mutation 'R5427:Pfas'

426969

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

042993-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5427 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69001153 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 176 (I176M)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021282
AA Change: I176M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: I176M

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172987

Meta Mutation Damage Score

0.4695

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	A	9: 92,352,596	C128Y	probably benign	Het
Aaas	A	G	15: 102,339,950	V277A	possibly damaging	Het
Adcy7	G	A	8: 88,326,201		probably null	Het
Adgrg5	A	T	8: 94,935,102	D157V	probably benign	Het
Akap13	A	G	7: 75,728,869	N2090S	possibly damaging	Het
Alpi	T	C	1: 87,101,354	N33D	probably benign	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Anp32a	A	G	9: 62,377,316		probably benign	Het
Atg4b	G	C	1: 93,775,206	K86N	probably damaging	Het
Bbx	T	C	16: 50,280,497	T12A	probably benign	Het
Catsperg2	T	C	7: 29,714,850	T377A	possibly damaging	Het
Ccdc158	T	C	5: 92,648,962	Q505R	probably damaging	Het
Cep135	T	A	5: 76,638,202	S1051T	probably benign	Het
Cryab	A	G	9: 50,756,293	D109G	probably damaging	Het
Crym	A	C	7: 120,199,222		probably benign	Het
Csf2rb2	T	A	15: 78,288,911	S250C	probably damaging	Het
Diaph1	A	T	18: 37,890,595	V730E	unknown	Het
Eci3	G	T	13: 34,959,948	L65M	possibly damaging	Het
Erg28	T	C	12: 85,819,567	N46D	probably damaging	Het
Fam89b	A	G	19: 5,728,791	S127P	probably benign	Het
Fign	A	G	2: 63,978,998	Y643H	probably damaging	Het
Galk2	T	C	2: 125,946,821	V265A	probably benign	Het
Gclm	T	C	3: 122,266,327	V252A	probably damaging	Het
Git2	A	G	5: 114,730,328	S584P	possibly damaging	Het
Gm38394	A	G	1: 133,657,595	V668A	possibly damaging	Het
Iqcf3	T	C	9: 106,543,860		probably null	Het
Kcnk3	A	G	5: 30,622,295	T230A	possibly damaging	Het
Myh10	T	C	11: 68,802,931	L1486P	probably damaging	Het
Myom2	C	A	8: 15,113,764	A1006E	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nampt	A	T	12: 32,834,915	H111L	probably benign	Het
Nid1	A	G	13: 13,483,683	Y671C	probably damaging	Het
Npy5r	G	A	8: 66,681,020	R374C	probably damaging	Het
Olfr1116	A	T	2: 87,269,514	K244N	probably benign	Het
Olfr1487	A	T	19: 13,619,350	S20C	probably benign	Het
Palld	C	T	8: 61,550,072	C720Y	probably benign	Het
Pcsk6	C	T	7: 66,033,899	T606M	probably benign	Het
Pi4kb	A	G	3: 94,994,207	D395G	probably benign	Het
Plod3	A	T	5: 136,991,788	Y547F	probably damaging	Het
Pnpo	T	C	11: 96,943,807	Y21C	probably benign	Het
Rgs1	A	T	1: 144,246,280	C118*	probably null	Het
Rrnad1	T	C	3: 87,924,332		probably benign	Het
Slc22a27	A	G	19: 7,879,388		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sppl2c	G	A	11: 104,187,867	V498I	probably benign	Het
Stim2	A	T	5: 54,110,939	I448F	possibly damaging	Het
Sulf1	A	T	1: 12,796,912	T107S	possibly damaging	Het
Tenm3	A	G	8: 48,236,564	V1996A	probably damaging	Het
Timm23	G	A	14: 32,189,146	T171I	possibly damaging	Het
Tssk2	A	G	16: 17,898,865	D44G	probably damaging	Het
Vmn2r28	A	T	7: 5,486,377	Y488N	probably damaging	Het
Zbtb48	A	G	4: 152,020,651	F518S	probably damaging	Het
Zfp709	A	G	8: 71,889,132	E135G	probably benign	Het
Zfp788	G	A	7: 41,649,652	V571I	possibly damaging	Het
Zfp963	A	G	8: 69,743,456	S116P	probably benign	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	unclassified	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCGCTGCAGCTCTTGAAAG -3'
(R):5'- TTATGACTGGATCTTCCCAACAC -3'

Sequencing Primer
(F):5'- CTTGGTATAGAAATCGAGGTCCC -3'
(R):5'- GGATCTTCCCAACACCAGTTTAC -3'

Posted On

2016-09-01