Mutagenetix > Incidental Mutations

Incidental Mutation 'R5427:Sntb1'

426976

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

042993-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R5427 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55642795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 461 (G461R)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

AlphaFold

Q99L88

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	A	9: 92,352,596	C128Y	probably benign	Het
Aaas	A	G	15: 102,339,950	V277A	possibly damaging	Het
Adcy7	G	A	8: 88,326,201		probably null	Het
Adgrg5	A	T	8: 94,935,102	D157V	probably benign	Het
Akap13	A	G	7: 75,728,869	N2090S	possibly damaging	Het
Alpi	T	C	1: 87,101,354	N33D	probably benign	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Anp32a	A	G	9: 62,377,316		probably benign	Het
Atg4b	G	C	1: 93,775,206	K86N	probably damaging	Het
Bbx	T	C	16: 50,280,497	T12A	probably benign	Het
Catsperg2	T	C	7: 29,714,850	T377A	possibly damaging	Het
Ccdc158	T	C	5: 92,648,962	Q505R	probably damaging	Het
Cep135	T	A	5: 76,638,202	S1051T	probably benign	Het
Cryab	A	G	9: 50,756,293	D109G	probably damaging	Het
Crym	A	C	7: 120,199,222		probably benign	Het
Csf2rb2	T	A	15: 78,288,911	S250C	probably damaging	Het
Diaph1	A	T	18: 37,890,595	V730E	unknown	Het
Eci3	G	T	13: 34,959,948	L65M	possibly damaging	Het
Erg28	T	C	12: 85,819,567	N46D	probably damaging	Het
Fam89b	A	G	19: 5,728,791	S127P	probably benign	Het
Fign	A	G	2: 63,978,998	Y643H	probably damaging	Het
Galk2	T	C	2: 125,946,821	V265A	probably benign	Het
Gclm	T	C	3: 122,266,327	V252A	probably damaging	Het
Git2	A	G	5: 114,730,328	S584P	possibly damaging	Het
Gm38394	A	G	1: 133,657,595	V668A	possibly damaging	Het
Iqcf3	T	C	9: 106,543,860		probably null	Het
Kcnk3	A	G	5: 30,622,295	T230A	possibly damaging	Het
Myh10	T	C	11: 68,802,931	L1486P	probably damaging	Het
Myom2	C	A	8: 15,113,764	A1006E	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nampt	A	T	12: 32,834,915	H111L	probably benign	Het
Nid1	A	G	13: 13,483,683	Y671C	probably damaging	Het
Npy5r	G	A	8: 66,681,020	R374C	probably damaging	Het
Olfr1116	A	T	2: 87,269,514	K244N	probably benign	Het
Olfr1487	A	T	19: 13,619,350	S20C	probably benign	Het
Palld	C	T	8: 61,550,072	C720Y	probably benign	Het
Pcsk6	C	T	7: 66,033,899	T606M	probably benign	Het
Pfas	T	C	11: 69,001,153	I176M	possibly damaging	Het
Pi4kb	A	G	3: 94,994,207	D395G	probably benign	Het
Plod3	A	T	5: 136,991,788	Y547F	probably damaging	Het
Pnpo	T	C	11: 96,943,807	Y21C	probably benign	Het
Rgs1	A	T	1: 144,246,280	C118*	probably null	Het
Rrnad1	T	C	3: 87,924,332		probably benign	Het
Slc22a27	A	G	19: 7,879,388		probably null	Het
Sppl2c	G	A	11: 104,187,867	V498I	probably benign	Het
Stim2	A	T	5: 54,110,939	I448F	possibly damaging	Het
Sulf1	A	T	1: 12,796,912	T107S	possibly damaging	Het
Tenm3	A	G	8: 48,236,564	V1996A	probably damaging	Het
Timm23	G	A	14: 32,189,146	T171I	possibly damaging	Het
Tssk2	A	G	16: 17,898,865	D44G	probably damaging	Het
Vmn2r28	A	T	7: 5,486,377	Y488N	probably damaging	Het
Zbtb48	A	G	4: 152,020,651	F518S	probably damaging	Het
Zfp709	A	G	8: 71,889,132	E135G	probably benign	Het
Zfp788	G	A	7: 41,649,652	V571I	possibly damaging	Het
Zfp963	A	G	8: 69,743,456	S116P	probably benign	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGTAGTCAGGCCGCCTAC -3'
(R):5'- AAGAAATTCGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTCATTGCACATG -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'

Posted On

2016-09-01