Incidental Mutation 'R5427:Slc22a27'
ID426983
Institutional Source Beutler Lab
Gene Symbol Slc22a27
Ensembl Gene ENSMUSG00000067656
Gene Namesolute carrier family 22, member 27
SynonymsmOAT6 related protein, AB056442
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7864388-7966027 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 7879388 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075619] [ENSMUST00000182102]
Predicted Effect probably null
Transcript: ENSMUST00000075619
SMART Domains Protein: ENSMUSP00000093991
Gene: ENSMUSG00000067656

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.5e-25 PFAM
Pfam:MFS_1 140 372 1.3e-15 PFAM
Pfam:MFS_1 349 549 8.3e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182102
SMART Domains Protein: ENSMUSP00000138475
Gene: ENSMUSG00000067656

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 241 441 1.2e-11 PFAM
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Slc22a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Slc22a27 APN 19 7909743 missense possibly damaging 0.93
IGL02516:Slc22a27 APN 19 7864811 missense probably damaging 0.99
IGL02961:Slc22a27 APN 19 7926521 missense probably damaging 0.99
IGL03008:Slc22a27 APN 19 7909702 missense possibly damaging 0.92
PIT4544001:Slc22a27 UTSW 19 7909738 missense probably damaging 1.00
R0172:Slc22a27 UTSW 19 7865836 nonsense probably null
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0280:Slc22a27 UTSW 19 7896822 nonsense probably null
R0561:Slc22a27 UTSW 19 7880162 critical splice donor site probably null
R0597:Slc22a27 UTSW 19 7865884 missense probably benign 0.00
R1005:Slc22a27 UTSW 19 7926751 missense probably damaging 1.00
R1165:Slc22a27 UTSW 19 7909694 intron probably null
R1217:Slc22a27 UTSW 19 7926668 missense probably benign 0.01
R1533:Slc22a27 UTSW 19 7866983 missense possibly damaging 0.79
R1940:Slc22a27 UTSW 19 7909727 missense probably damaging 1.00
R3714:Slc22a27 UTSW 19 7926450 missense possibly damaging 0.75
R3959:Slc22a27 UTSW 19 7910049 missense probably damaging 1.00
R4059:Slc22a27 UTSW 19 7879608 splice site probably benign
R4249:Slc22a27 UTSW 19 7925879 missense possibly damaging 0.64
R4748:Slc22a27 UTSW 19 7925876 missense probably benign
R5220:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5221:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5232:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5330:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5331:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5345:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5534:Slc22a27 UTSW 19 7926631 missense probably damaging 1.00
R5691:Slc22a27 UTSW 19 7926670 missense possibly damaging 0.90
R5828:Slc22a27 UTSW 19 7926402 missense probably damaging 1.00
R5878:Slc22a27 UTSW 19 7926757 missense probably benign 0.01
R5918:Slc22a27 UTSW 19 7910046 missense possibly damaging 0.91
R6185:Slc22a27 UTSW 19 7926588 missense probably benign 0.14
R6901:Slc22a27 UTSW 19 7926579 missense probably damaging 1.00
R7139:Slc22a27 UTSW 19 7926547 missense probably damaging 1.00
R7336:Slc22a27 UTSW 19 7926689 missense probably benign 0.02
R7502:Slc22a27 UTSW 19 7926382 missense probably damaging 1.00
R7556:Slc22a27 UTSW 19 7865754 missense probably damaging 0.98
R7737:Slc22a27 UTSW 19 7896762 missense probably damaging 0.99
R7860:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R7943:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R8050:Slc22a27 UTSW 19 7880167 missense probably benign 0.18
RF012:Slc22a27 UTSW 19 7926584 missense probably benign 0.07
Z1177:Slc22a27 UTSW 19 7909730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATTTCCACCATGGCTACCAG -3'
(R):5'- TTTTGGCCTGGCAGTTCAC -3'

Sequencing Primer
(F):5'- CACCATGGCTACCAGAAATTGTTTG -3'
(R):5'- TGGCAGTTCACCTCCAAC -3'
Posted On2016-09-01