Incidental Mutation 'R5428:Ptgs1'
ID426990
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Nameprostaglandin-endoperoxide synthase 1
SynonymsPghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36230426-36252272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36245268 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 415 (M415V)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
Predicted Effect probably benign
Transcript: ENSMUST00000062069
AA Change: M415V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: M415V

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202733
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36237219 missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36242971 missense probably null 0.93
IGL02952:Ptgs1 APN 2 36251241 missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36237705 missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36240680 missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36249193 missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36240856 splice site probably benign
R1563:Ptgs1 UTSW 2 36245202 missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36242770 missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36237656 missense probably benign
R2080:Ptgs1 UTSW 2 36242847 nonsense probably null
R2116:Ptgs1 UTSW 2 36237696 nonsense probably null
R4073:Ptgs1 UTSW 2 36237776 missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36251334 missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36237255 missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36237282 missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36237222 missense probably damaging 1.00
R5918:Ptgs1 UTSW 2 36251077 missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36251178 missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36251119 missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36237285 missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36251299 missense probably benign
R7020:Ptgs1 UTSW 2 36251029 missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36245210 missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36245211 missense possibly damaging 0.92
R7873:Ptgs1 UTSW 2 36251280 missense probably damaging 1.00
R7956:Ptgs1 UTSW 2 36251280 missense probably damaging 1.00
Z1176:Ptgs1 UTSW 2 36240776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGGAGTATGTGCAGCAC -3'
(R):5'- ACACAGGGATGTTTACAACCAC -3'

Sequencing Primer
(F):5'- GCAGCACTTGAGTGGCTATTTCC -3'
(R):5'- CAGGGATGTTTACAACCACCTGTAG -3'
Posted On2016-09-01