Mutagenetix > Incidental Mutations

Incidental Mutation 'R5428:Ptgs1'

426990

Institutional Source

Beutler Lab

Gene Symbol

Ptgs1

Ensembl Gene

ENSMUSG00000047250

Gene Name

prostaglandin-endoperoxide synthase 1

Synonyms

Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1

MMRRC Submission

042994-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R5428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36230426-36252272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36245268 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 415 (M415V)

Ref Sequence

ENSEMBL: ENSMUSP00000059977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062069]

Predicted Effect

probably benign
Transcript: ENSMUST00000062069
AA Change: M415V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: M415V

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
EGF	37	72	2.48e1	SMART
low complexity region	172	185	N/A	INTRINSIC
low complexity region	200	214	N/A	INTRINSIC
Pfam:An_peroxidase	221	528	1.5e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149930

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202733

Meta Mutation Damage Score

0.0890

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,635,918	V324L	probably benign	Het
Abl2	T	C	1: 156,642,111	C982R	probably damaging	Het
Adgrl4	G	A	3: 151,542,686	C665Y	probably damaging	Het
Adra1d	A	G	2: 131,561,403	S256P	probably damaging	Het
Aipl1	T	A	11: 72,030,487	Y194F	probably benign	Het
Arfgef1	C	A	1: 10,160,835	D1150Y	probably damaging	Het
Arl14epl	A	T	18: 46,926,320	M1L	possibly damaging	Het
Colgalt1	G	T	8: 71,622,776	R442L	probably damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dach1	A	G	14: 98,169,269	V14A	unknown	Het
Defa30	A	G	8: 21,135,403	D61G	probably benign	Het
Dnaja2	A	T	8: 85,540,175	C308S	probably benign	Het
Emc4	A	G	2: 112,367,355		probably benign	Het
Foxp1	A	G	6: 99,016,631	V104A	probably damaging	Het
Fry	T	G	5: 150,405,359	L1319R	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gja10	T	A	4: 32,601,169	H405L	probably benign	Het
Gm27047	A	G	6: 130,630,564		noncoding transcript	Het
Grm1	T	A	10: 10,719,563	T774S	probably damaging	Het
Gtse1	A	C	15: 85,862,139	D52A	probably benign	Het
Kctd17	T	A	15: 78,428,782	F42Y	probably damaging	Het
Kndc1	A	G	7: 139,908,962	K178E	probably damaging	Het
Lrrc74b	T	C	16: 17,558,261	E175G	probably damaging	Het
Macf1	A	G	4: 123,384,868	I5927T	probably damaging	Het
Maml2	A	G	9: 13,705,895	N935S	probably benign	Het
Man2a1	A	G	17: 64,712,300	I720V	probably benign	Het
Map3k5	C	T	10: 20,023,653	H219Y	possibly damaging	Het
Map4k5	T	C	12: 69,838,013	T314A	possibly damaging	Het
Mast3	A	G	8: 70,784,733	V615A	possibly damaging	Het
Mcmbp	C	T	7: 128,704,524	V457I	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nacc1	T	C	8: 84,676,154	I337V	probably damaging	Het
Nipbl	T	C	15: 8,330,296	D1475G	probably benign	Het
Orc1	T	A	4: 108,599,940	D392E	probably benign	Het
Pappa2	T	C	1: 158,814,785	T1297A	possibly damaging	Het
Plag1	C	T	4: 3,905,538	V51I	possibly damaging	Het
Ppp1r12a	G	A	10: 108,253,347	E616K	possibly damaging	Het
Ralgapa2	C	T	2: 146,334,494	E1683K	probably damaging	Het
Rap2a	T	A	14: 120,478,994	F90I	probably benign	Het
Rcvrn	A	G	11: 67,700,049	E153G	possibly damaging	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skil	T	A	3: 31,097,498	D56E	probably benign	Het
Slc22a18	G	T	7: 143,479,345	G57W	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Synj1	T	C	16: 90,991,518	D154G	probably damaging	Het
Tbc1d24	A	T	17: 24,181,772	N156K	probably benign	Het
Tcea1	A	T	1: 4,880,345		probably benign	Het
Tmc3	T	C	7: 83,612,547	V611A	probably damaging	Het
Tnrc6c	A	G	11: 117,700,762	M1V	probably null	Het
Tomm5	A	T	4: 45,106,689		probably benign	Het
Ttc6	A	G	12: 57,689,834	K1207R	probably null	Het
Ttn	T	C	2: 76,761,104	T12747A	possibly damaging	Het
Ttn	A	T	2: 76,885,136		probably benign	Het
Utrn	T	C	10: 12,693,431	D1147G	probably benign	Het
Vmn1r53	T	C	6: 90,223,413	I310V	probably benign	Het
Washc4	A	C	10: 83,574,522	D658A	probably benign	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Ylpm1	T	C	12: 85,030,229	F1243L	probably benign	Het
Zbtb24	T	C	10: 41,464,788	S605P	probably benign	Het
Zfy1	T	G	Y: 726,205	H520P	possibly damaging	Het

Other mutations in Ptgs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Ptgs1	APN	2	36237219	missense	probably damaging	1.00
IGL02345:Ptgs1	APN	2	36242971	missense	probably null	0.93
IGL02952:Ptgs1	APN	2	36251241	missense	probably benign	0.00
IGL03306:Ptgs1	APN	2	36237705	missense	probably damaging	1.00
PIT4431001:Ptgs1	UTSW	2	36240680	missense	probably damaging	1.00
R0468:Ptgs1	UTSW	2	36249193	missense	probably damaging	1.00
R0638:Ptgs1	UTSW	2	36240856	splice site	probably benign
R1563:Ptgs1	UTSW	2	36245202	missense	possibly damaging	0.53
R1858:Ptgs1	UTSW	2	36242770	missense	probably benign	0.19
R2012:Ptgs1	UTSW	2	36237656	missense	probably benign
R2080:Ptgs1	UTSW	2	36242847	nonsense	probably null
R2116:Ptgs1	UTSW	2	36237696	nonsense	probably null
R4073:Ptgs1	UTSW	2	36237776	missense	probably damaging	1.00
R4163:Ptgs1	UTSW	2	36251334	missense	possibly damaging	0.87
R4862:Ptgs1	UTSW	2	36237255	missense	probably damaging	1.00
R5062:Ptgs1	UTSW	2	36237282	missense	probably damaging	1.00
R5071:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5072:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5073:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5074:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5373:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5374:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5419:Ptgs1	UTSW	2	36237222	missense	probably damaging	1.00
R5918:Ptgs1	UTSW	2	36251077	missense	probably damaging	1.00
R6134:Ptgs1	UTSW	2	36251178	missense	probably damaging	1.00
R6181:Ptgs1	UTSW	2	36251119	missense	probably damaging	1.00
R6240:Ptgs1	UTSW	2	36237285	missense	probably damaging	1.00
R6979:Ptgs1	UTSW	2	36251299	missense	probably benign
R7020:Ptgs1	UTSW	2	36251029	missense	probably damaging	1.00
R7445:Ptgs1	UTSW	2	36245210	missense	probably benign	0.06
R7557:Ptgs1	UTSW	2	36245211	missense	possibly damaging	0.92
R7873:Ptgs1	UTSW	2	36251280	missense	probably damaging	1.00
R8215:Ptgs1	UTSW	2	36251167	missense	probably damaging	1.00
Z1176:Ptgs1	UTSW	2	36240776	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGAGGAGTATGTGCAGCAC -3'
(R):5'- ACACAGGGATGTTTACAACCAC -3'

Sequencing Primer
(F):5'- GCAGCACTTGAGTGGCTATTTCC -3'
(R):5'- CAGGGATGTTTACAACCACCTGTAG -3'

Posted On

2016-09-01