Incidental Mutation 'R5428:Adgrl4'
ID426997
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 151542686 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 665 (C665Y)
Ref Sequence ENSEMBL: ENSMUSP00000041939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977]
Predicted Effect probably damaging
Transcript: ENSMUST00000046977
AA Change: C665Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: C665Y

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
R7527:Adgrl4 UTSW 3 151439250 missense probably benign 0.08
R7597:Adgrl4 UTSW 3 151543258 missense probably damaging 1.00
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTTGCATCAAACCAC -3'
(R):5'- GTCACACTTCAAGGCAACAG -3'

Sequencing Primer
(F):5'- TGTTGCATCAAACCACAAGCCAG -3'
(R):5'- GTCACACTTCAAGGCAACAGTTTTTC -3'
Posted On2016-09-01