Incidental Mutation 'R0494:Nedd4l'
ID 42700
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 038691-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 65306092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 335 (S335A)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080418
AA Change: S335A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: S335A

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163516
AA Change: S456A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: S456A

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
AA Change: S315A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect possibly damaging
Transcript: ENSMUST00000226058
AA Change: S335A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,402,339 (GRCm39) I116V probably benign Het
Abhd18 T C 3: 40,871,123 (GRCm39) F94S probably damaging Het
Adam28 T A 14: 68,868,241 (GRCm39) probably benign Het
Afg2a G C 3: 37,486,312 (GRCm39) D345H possibly damaging Het
Amn1 A T 6: 149,086,634 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,170,199 (GRCm39) V993A probably damaging Het
Arhgap33 A T 7: 30,223,921 (GRCm39) S703T probably damaging Het
Arhgef1 T C 7: 24,618,785 (GRCm39) probably benign Het
Atg2a A G 19: 6,303,407 (GRCm39) Y1083C probably damaging Het
Atp2a3 T C 11: 72,872,731 (GRCm39) F760L probably damaging Het
B9d1 A G 11: 61,403,271 (GRCm39) probably benign Het
Batf C T 12: 85,733,636 (GRCm39) probably benign Het
BC051019 T A 7: 109,317,182 (GRCm39) Y170F probably benign Het
Bphl T C 13: 34,221,754 (GRCm39) *37Q probably null Het
Cab39l T C 14: 59,737,008 (GRCm39) S43P probably damaging Het
Cad A G 5: 31,234,856 (GRCm39) probably benign Het
Cct4 T G 11: 22,946,014 (GRCm39) S119A probably benign Het
Cd163 G A 6: 124,288,408 (GRCm39) V280M probably damaging Het
Cd86 A G 16: 36,438,999 (GRCm39) probably benign Het
Cdh23 G A 10: 60,152,375 (GRCm39) probably benign Het
Cdhr5 A G 7: 140,852,431 (GRCm39) F145S probably damaging Het
Cdt1 T C 8: 123,298,799 (GRCm39) S479P possibly damaging Het
Ces2g T C 8: 105,693,199 (GRCm39) V372A probably benign Het
Chrna3 T C 9: 54,929,562 (GRCm39) D92G probably damaging Het
Cndp1 A G 18: 84,637,658 (GRCm39) S359P probably benign Het
Cops4 A G 5: 100,676,528 (GRCm39) Q93R probably damaging Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dmp1 A T 5: 104,360,074 (GRCm39) D250V probably damaging Het
Dnajb2 C T 1: 75,216,278 (GRCm39) probably benign Het
Dock9 T C 14: 121,899,996 (GRCm39) T113A possibly damaging Het
Egln3 T A 12: 54,250,107 (GRCm39) I81F probably benign Het
Elapor2 G A 5: 9,470,723 (GRCm39) probably null Het
Elovl5 T C 9: 77,868,199 (GRCm39) V37A probably benign Het
Esco1 A T 18: 10,594,940 (GRCm39) N115K probably benign Het
Fat1 A T 8: 45,403,579 (GRCm39) N110I probably damaging Het
Fezf1 T A 6: 23,246,054 (GRCm39) K370N probably damaging Het
Galnt18 T A 7: 111,153,771 (GRCm39) K284N probably damaging Het
Glt8d1 C A 14: 30,733,580 (GRCm39) T355K possibly damaging Het
Gm17455 G A 10: 60,239,014 (GRCm39) R93H possibly damaging Het
Gng8 T A 7: 16,629,213 (GRCm39) D46E probably benign Het
Gpx4 T C 10: 79,892,011 (GRCm39) probably benign Het
Grk2 A T 19: 4,341,347 (GRCm39) N189K probably damaging Het
Grm5 T C 7: 87,779,989 (GRCm39) V1143A probably benign Het
Hibch A G 1: 52,942,055 (GRCm39) E237G possibly damaging Het
Hipk2 C T 6: 38,706,924 (GRCm39) A682T probably benign Het
Hmcn1 G T 1: 150,608,543 (GRCm39) probably benign Het
Htt A G 5: 34,979,188 (GRCm39) D857G possibly damaging Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Igsf8 A G 1: 172,146,265 (GRCm39) E421G probably benign Het
Kif26a T A 12: 112,145,905 (GRCm39) probably null Het
Klhl26 T C 8: 70,904,251 (GRCm39) Y519C probably damaging Het
Lamc1 A C 1: 153,122,682 (GRCm39) probably null Het
Mical3 A T 6: 120,936,162 (GRCm39) S1455T possibly damaging Het
Mitf G A 6: 97,971,390 (GRCm39) G186S probably benign Het
Ms4a15 G A 19: 10,958,722 (GRCm39) probably benign Het
Myo5b A G 18: 74,787,038 (GRCm39) E481G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nbeal2 C A 9: 110,456,255 (GRCm39) V1686L probably damaging Het
Nos1 A T 5: 118,043,539 (GRCm39) N605Y probably damaging Het
Nyx C A X: 13,353,508 (GRCm39) T454K probably benign Het
Or52n2 A G 7: 104,542,478 (GRCm39) L119P probably damaging Het
Or8g55 T A 9: 39,784,698 (GRCm39) N42K probably damaging Het
Pcdhb12 T A 18: 37,571,148 (GRCm39) F765I probably benign Het
Pex3 C T 10: 13,403,532 (GRCm39) G330R probably damaging Het
Pfkfb1 T C X: 149,417,609 (GRCm39) Y339H probably damaging Het
Pias1 G A 9: 62,794,593 (GRCm39) Q26* probably null Het
Pik3cg C A 12: 32,254,545 (GRCm39) V481L possibly damaging Het
Plcg2 C T 8: 118,282,843 (GRCm39) T108M probably damaging Het
Pon2 G A 6: 5,267,059 (GRCm39) probably benign Het
Ppef2 A T 5: 92,400,952 (GRCm39) probably benign Het
Pramel21 G T 4: 143,342,726 (GRCm39) V278F probably benign Het
Ptpn22 A G 3: 103,767,771 (GRCm39) K18E probably damaging Het
Pum2 C T 12: 8,771,736 (GRCm39) Q360* probably null Het
Rab10 A C 12: 3,302,723 (GRCm39) probably null Het
Ranbp2 T G 10: 58,303,254 (GRCm39) S809A possibly damaging Het
Rbms2 A G 10: 127,969,539 (GRCm39) V348A probably benign Het
Rnf213 A G 11: 119,316,838 (GRCm39) E988G possibly damaging Het
Rnf213 A T 11: 119,333,946 (GRCm39) M3052L probably damaging Het
Rpl14 C A 9: 120,403,428 (GRCm39) probably benign Het
Rplp0 A G 5: 115,697,931 (GRCm39) Y13C possibly damaging Het
Ryr1 A G 7: 28,703,218 (GRCm39) probably benign Het
Sac3d1 T C 19: 6,168,324 (GRCm39) E98G probably damaging Het
Scn10a T A 9: 119,453,166 (GRCm39) D1242V probably damaging Het
Scnn1b T C 7: 121,498,681 (GRCm39) Y74H probably damaging Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Sf3b4 C A 3: 96,081,017 (GRCm39) D108E probably damaging Het
Shprh T C 10: 11,032,935 (GRCm39) V307A probably damaging Het
Slc2a2 A G 3: 28,781,426 (GRCm39) D458G probably benign Het
Strc T C 2: 121,210,014 (GRCm39) D103G probably damaging Het
Synrg T C 11: 83,910,369 (GRCm39) I923T probably benign Het
Tango6 G T 8: 107,462,314 (GRCm39) probably benign Het
Tas2r106 A G 6: 131,655,539 (GRCm39) L104P probably damaging Het
Tat C T 8: 110,718,316 (GRCm39) P67L probably damaging Het
Tln2 A C 9: 67,262,479 (GRCm39) S593A probably benign Het
Tmem94 A G 11: 115,685,607 (GRCm39) probably null Het
Tppp3 G A 8: 106,194,804 (GRCm39) A109V probably benign Het
Trank1 T C 9: 111,220,361 (GRCm39) F2366S probably benign Het
Trpc5 T A X: 143,264,392 (GRCm39) Y155F probably damaging Het
Trpv1 A G 11: 73,151,268 (GRCm39) T451A probably benign Het
Ttc9 C A 12: 81,678,423 (GRCm39) A82E probably damaging Het
Ttll11 T A 2: 35,834,886 (GRCm39) N180I probably damaging Het
Ttn T C 2: 76,566,743 (GRCm39) N28050S possibly damaging Het
Vmn2r73 G T 7: 85,522,140 (GRCm39) H66Q probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wnt3 G A 11: 103,703,141 (GRCm39) C208Y probably damaging Het
Zfp521 C A 18: 13,978,325 (GRCm39) C696F probably damaging Het
Zfp521 T C 18: 13,979,927 (GRCm39) D162G probably damaging Het
Zfp869 A T 8: 70,159,054 (GRCm39) H506Q probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGAAAGCAGCCCTCACC -3'
(R):5'- GCCTTTGCCACCAACACATGACTG -3'

Sequencing Primer
(F):5'- CTTTCAGAAAGTGAGCCTATGACC -3'
(R):5'- ACACATGACTGCTCAGTGTGG -3'
Posted On 2013-05-23