Incidental Mutation 'R5428:Wrap73'
ID 427003
Institutional Source Beutler Lab
Gene Symbol Wrap73
Ensembl Gene ENSMUSG00000029029
Gene Name WD repeat containing, antisense to Trp73
Synonyms DD57, Wdr8, 5330425N03Rik, 2610044M17Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock # R5428 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 154142372-154167420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 154145274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 34 (R34Q)
Ref Sequence ENSEMBL: ENSMUSP00000030895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895]
AlphaFold Q9JM98
Predicted Effect probably damaging
Transcript: ENSMUST00000030895
AA Change: R34Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029
AA Change: R34Q

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Meta Mutation Damage Score 0.4370 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Wrap73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Wrap73 APN 4 154152639 missense probably damaging 0.99
IGL01562:Wrap73 APN 4 154145337 missense possibly damaging 0.63
IGL01863:Wrap73 APN 4 154145333 missense probably benign 0.02
IGL02342:Wrap73 APN 4 154148780 missense probably benign 0.36
IGL03012:Wrap73 APN 4 154145234 splice site probably benign
IGL03303:Wrap73 APN 4 154146543 missense probably damaging 0.98
R0128:Wrap73 UTSW 4 154142500 missense possibly damaging 0.81
R0455:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R0524:Wrap73 UTSW 4 154145307 missense probably damaging 1.00
R0528:Wrap73 UTSW 4 154145319 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154151649 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154156154 missense possibly damaging 0.91
R0633:Wrap73 UTSW 4 154142491 missense probably damaging 0.98
R1118:Wrap73 UTSW 4 154152427 splice site probably null
R1669:Wrap73 UTSW 4 154156131 missense probably damaging 0.99
R1725:Wrap73 UTSW 4 154148752 missense possibly damaging 0.73
R2070:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R4530:Wrap73 UTSW 4 154156707 unclassified probably benign
R4669:Wrap73 UTSW 4 154151696 missense probably benign 0.26
R4969:Wrap73 UTSW 4 154152681 missense probably damaging 1.00
R5254:Wrap73 UTSW 4 154155346 missense probably benign 0.00
R5334:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5431:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5728:Wrap73 UTSW 4 154154642 critical splice donor site probably null
R7338:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7426:Wrap73 UTSW 4 154156127 missense probably damaging 1.00
R7480:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7680:Wrap73 UTSW 4 154156622 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTTGTACAAATTTGTGGGTTAGAG -3'
(R):5'- TTCAAGGCCCACAGACATGTAG -3'

Sequencing Primer
(F):5'- ACTTTTAAACTTTTGAATGCTCCACC -3'
(R):5'- TGTAGCACCCATCTATACACTCTAC -3'
Posted On 2016-09-01