Incidental Mutation 'R5428:Foxp1'
ID427007
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Nameforkhead box P1
Synonyms4932443N09Rik, 3110052D19Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location98925338-99522721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99016631 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000108952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000123992] [ENSMUST00000124058] [ENSMUST00000154163] [ENSMUST00000175670] [ENSMUST00000175886] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177229] [ENSMUST00000177230] [ENSMUST00000177307] [ENSMUST00000177437] [ENSMUST00000177507]
Predicted Effect probably benign
Transcript: ENSMUST00000074346
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113321
SMART Domains Protein: ENSMUSP00000108947
Gene: ENSMUSG00000030067

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113322
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113324
AA Change: V136A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113326
AA Change: V104A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113328
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113329
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123992
AA Change: V6A
SMART Domains Protein: ENSMUSP00000117550
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124058
AA Change: V6A
SMART Domains Protein: ENSMUSP00000120244
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154163
AA Change: V6A
SMART Domains Protein: ENSMUSP00000121404
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175670
AA Change: V6A
Predicted Effect unknown
Transcript: ENSMUST00000175886
AA Change: V6A
SMART Domains Protein: ENSMUSP00000135517
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176565
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176632
AA Change: V104A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176850
AA Change: V104A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177229
AA Change: V6A
SMART Domains Protein: ENSMUSP00000134817
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
ZnF_C2H2 206 231 8.67e-1 SMART
low complexity region 243 255 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
FH 363 444 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177230
AA Change: V104A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177307
AA Change: V136A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: V136A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177437
AA Change: V6A
SMART Domains Protein: ENSMUSP00000135809
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 61 N/A INTRINSIC
low complexity region 70 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
FH 362 443 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177507
AA Change: V6A
SMART Domains Protein: ENSMUSP00000134869
Gene: ENSMUSG00000030067
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 10 61 N/A INTRINSIC
low complexity region 70 104 N/A INTRINSIC
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R2338:Foxp1 UTSW 6 99003293 missense possibly damaging 0.61
R3896:Foxp1 UTSW 6 99075936 missense probably benign 0.33
R5006:Foxp1 UTSW 6 99162858 missense probably damaging 0.98
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7559:Foxp1 UTSW 6 98945560 missense unknown
R7715:Foxp1 UTSW 6 98945660 missense unknown
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACCAGGTGGGATTCTGTC -3'
(R):5'- ACAAGGGTTTGCATAGGGTCTG -3'

Sequencing Primer
(F):5'- ATGTCCATTCTCCAACAGGG -3'
(R):5'- GCATAGGGTCTGTGCTTATATCTC -3'
Posted On2016-09-01