Incidental Mutation 'R0494:Myo5b'
ID 42701
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 038691-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74787038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 481 (E481G)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: E481G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: E481G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: E481G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: E481G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Meta Mutation Damage Score 0.9569 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,402,339 (GRCm39) I116V probably benign Het
Abhd18 T C 3: 40,871,123 (GRCm39) F94S probably damaging Het
Adam28 T A 14: 68,868,241 (GRCm39) probably benign Het
Afg2a G C 3: 37,486,312 (GRCm39) D345H possibly damaging Het
Amn1 A T 6: 149,086,634 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,170,199 (GRCm39) V993A probably damaging Het
Arhgap33 A T 7: 30,223,921 (GRCm39) S703T probably damaging Het
Arhgef1 T C 7: 24,618,785 (GRCm39) probably benign Het
Atg2a A G 19: 6,303,407 (GRCm39) Y1083C probably damaging Het
Atp2a3 T C 11: 72,872,731 (GRCm39) F760L probably damaging Het
B9d1 A G 11: 61,403,271 (GRCm39) probably benign Het
Batf C T 12: 85,733,636 (GRCm39) probably benign Het
BC051019 T A 7: 109,317,182 (GRCm39) Y170F probably benign Het
Bphl T C 13: 34,221,754 (GRCm39) *37Q probably null Het
Cab39l T C 14: 59,737,008 (GRCm39) S43P probably damaging Het
Cad A G 5: 31,234,856 (GRCm39) probably benign Het
Cct4 T G 11: 22,946,014 (GRCm39) S119A probably benign Het
Cd163 G A 6: 124,288,408 (GRCm39) V280M probably damaging Het
Cd86 A G 16: 36,438,999 (GRCm39) probably benign Het
Cdh23 G A 10: 60,152,375 (GRCm39) probably benign Het
Cdhr5 A G 7: 140,852,431 (GRCm39) F145S probably damaging Het
Cdt1 T C 8: 123,298,799 (GRCm39) S479P possibly damaging Het
Ces2g T C 8: 105,693,199 (GRCm39) V372A probably benign Het
Chrna3 T C 9: 54,929,562 (GRCm39) D92G probably damaging Het
Cndp1 A G 18: 84,637,658 (GRCm39) S359P probably benign Het
Cops4 A G 5: 100,676,528 (GRCm39) Q93R probably damaging Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dmp1 A T 5: 104,360,074 (GRCm39) D250V probably damaging Het
Dnajb2 C T 1: 75,216,278 (GRCm39) probably benign Het
Dock9 T C 14: 121,899,996 (GRCm39) T113A possibly damaging Het
Egln3 T A 12: 54,250,107 (GRCm39) I81F probably benign Het
Elapor2 G A 5: 9,470,723 (GRCm39) probably null Het
Elovl5 T C 9: 77,868,199 (GRCm39) V37A probably benign Het
Esco1 A T 18: 10,594,940 (GRCm39) N115K probably benign Het
Fat1 A T 8: 45,403,579 (GRCm39) N110I probably damaging Het
Fezf1 T A 6: 23,246,054 (GRCm39) K370N probably damaging Het
Galnt18 T A 7: 111,153,771 (GRCm39) K284N probably damaging Het
Glt8d1 C A 14: 30,733,580 (GRCm39) T355K possibly damaging Het
Gm17455 G A 10: 60,239,014 (GRCm39) R93H possibly damaging Het
Gng8 T A 7: 16,629,213 (GRCm39) D46E probably benign Het
Gpx4 T C 10: 79,892,011 (GRCm39) probably benign Het
Grk2 A T 19: 4,341,347 (GRCm39) N189K probably damaging Het
Grm5 T C 7: 87,779,989 (GRCm39) V1143A probably benign Het
Hibch A G 1: 52,942,055 (GRCm39) E237G possibly damaging Het
Hipk2 C T 6: 38,706,924 (GRCm39) A682T probably benign Het
Hmcn1 G T 1: 150,608,543 (GRCm39) probably benign Het
Htt A G 5: 34,979,188 (GRCm39) D857G possibly damaging Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Igsf8 A G 1: 172,146,265 (GRCm39) E421G probably benign Het
Kif26a T A 12: 112,145,905 (GRCm39) probably null Het
Klhl26 T C 8: 70,904,251 (GRCm39) Y519C probably damaging Het
Lamc1 A C 1: 153,122,682 (GRCm39) probably null Het
Mical3 A T 6: 120,936,162 (GRCm39) S1455T possibly damaging Het
Mitf G A 6: 97,971,390 (GRCm39) G186S probably benign Het
Ms4a15 G A 19: 10,958,722 (GRCm39) probably benign Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nbeal2 C A 9: 110,456,255 (GRCm39) V1686L probably damaging Het
Nedd4l T G 18: 65,306,092 (GRCm39) S335A possibly damaging Het
Nos1 A T 5: 118,043,539 (GRCm39) N605Y probably damaging Het
Nyx C A X: 13,353,508 (GRCm39) T454K probably benign Het
Or52n2 A G 7: 104,542,478 (GRCm39) L119P probably damaging Het
Or8g55 T A 9: 39,784,698 (GRCm39) N42K probably damaging Het
Pcdhb12 T A 18: 37,571,148 (GRCm39) F765I probably benign Het
Pex3 C T 10: 13,403,532 (GRCm39) G330R probably damaging Het
Pfkfb1 T C X: 149,417,609 (GRCm39) Y339H probably damaging Het
Pias1 G A 9: 62,794,593 (GRCm39) Q26* probably null Het
Pik3cg C A 12: 32,254,545 (GRCm39) V481L possibly damaging Het
Plcg2 C T 8: 118,282,843 (GRCm39) T108M probably damaging Het
Pon2 G A 6: 5,267,059 (GRCm39) probably benign Het
Ppef2 A T 5: 92,400,952 (GRCm39) probably benign Het
Pramel21 G T 4: 143,342,726 (GRCm39) V278F probably benign Het
Ptpn22 A G 3: 103,767,771 (GRCm39) K18E probably damaging Het
Pum2 C T 12: 8,771,736 (GRCm39) Q360* probably null Het
Rab10 A C 12: 3,302,723 (GRCm39) probably null Het
Ranbp2 T G 10: 58,303,254 (GRCm39) S809A possibly damaging Het
Rbms2 A G 10: 127,969,539 (GRCm39) V348A probably benign Het
Rnf213 A G 11: 119,316,838 (GRCm39) E988G possibly damaging Het
Rnf213 A T 11: 119,333,946 (GRCm39) M3052L probably damaging Het
Rpl14 C A 9: 120,403,428 (GRCm39) probably benign Het
Rplp0 A G 5: 115,697,931 (GRCm39) Y13C possibly damaging Het
Ryr1 A G 7: 28,703,218 (GRCm39) probably benign Het
Sac3d1 T C 19: 6,168,324 (GRCm39) E98G probably damaging Het
Scn10a T A 9: 119,453,166 (GRCm39) D1242V probably damaging Het
Scnn1b T C 7: 121,498,681 (GRCm39) Y74H probably damaging Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Sf3b4 C A 3: 96,081,017 (GRCm39) D108E probably damaging Het
Shprh T C 10: 11,032,935 (GRCm39) V307A probably damaging Het
Slc2a2 A G 3: 28,781,426 (GRCm39) D458G probably benign Het
Strc T C 2: 121,210,014 (GRCm39) D103G probably damaging Het
Synrg T C 11: 83,910,369 (GRCm39) I923T probably benign Het
Tango6 G T 8: 107,462,314 (GRCm39) probably benign Het
Tas2r106 A G 6: 131,655,539 (GRCm39) L104P probably damaging Het
Tat C T 8: 110,718,316 (GRCm39) P67L probably damaging Het
Tln2 A C 9: 67,262,479 (GRCm39) S593A probably benign Het
Tmem94 A G 11: 115,685,607 (GRCm39) probably null Het
Tppp3 G A 8: 106,194,804 (GRCm39) A109V probably benign Het
Trank1 T C 9: 111,220,361 (GRCm39) F2366S probably benign Het
Trpc5 T A X: 143,264,392 (GRCm39) Y155F probably damaging Het
Trpv1 A G 11: 73,151,268 (GRCm39) T451A probably benign Het
Ttc9 C A 12: 81,678,423 (GRCm39) A82E probably damaging Het
Ttll11 T A 2: 35,834,886 (GRCm39) N180I probably damaging Het
Ttn T C 2: 76,566,743 (GRCm39) N28050S possibly damaging Het
Vmn2r73 G T 7: 85,522,140 (GRCm39) H66Q probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wnt3 G A 11: 103,703,141 (GRCm39) C208Y probably damaging Het
Zfp521 C A 18: 13,978,325 (GRCm39) C696F probably damaging Het
Zfp521 T C 18: 13,979,927 (GRCm39) D162G probably damaging Het
Zfp869 A T 8: 70,159,054 (GRCm39) H506Q probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGTCCAGACCTTCTGTGGCACTTAG -3'
(R):5'- TGCGGATGCTTCTTCCAGACAATC -3'

Sequencing Primer
(F):5'- GTGGCACTTAGCTGCCATC -3'
(R):5'- CAGCTAGGAGACTTCACTGGTTC -3'
Posted On 2013-05-23