Incidental Mutation 'R5428:Mast3'
ID 427014
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 042994-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5428 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71237377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 615 (V615A)
Ref Sequence ENSEMBL: ENSMUSP00000128703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212875] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757]
AlphaFold Q3U214
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: V615A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V615A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect possibly damaging
Transcript: ENSMUST00000211948
AA Change: V599A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Meta Mutation Damage Score 0.2971 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 (GRCm39) V324L probably benign Het
Abl2 T C 1: 156,469,681 (GRCm39) C982R probably damaging Het
Adgrl4 G A 3: 151,248,323 (GRCm39) C665Y probably damaging Het
Adra1d A G 2: 131,403,323 (GRCm39) S256P probably damaging Het
Aipl1 T A 11: 71,921,313 (GRCm39) Y194F probably benign Het
Arfgef1 C A 1: 10,231,060 (GRCm39) D1150Y probably damaging Het
Arl14epl A T 18: 47,059,387 (GRCm39) M1L possibly damaging Het
Colgalt1 G T 8: 72,075,420 (GRCm39) R442L probably damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Dach1 A G 14: 98,406,705 (GRCm39) V14A unknown Het
Defa30 A G 8: 21,625,419 (GRCm39) D61G probably benign Het
Dnaja2 A T 8: 86,266,804 (GRCm39) C308S probably benign Het
Emc4 A G 2: 112,197,700 (GRCm39) probably benign Het
Foxp1 A G 6: 98,993,592 (GRCm39) V104A probably damaging Het
Fry T G 5: 150,328,824 (GRCm39) L1319R possibly damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gja10 T A 4: 32,601,169 (GRCm39) H405L probably benign Het
Gm27047 A G 6: 130,607,527 (GRCm39) noncoding transcript Het
Grm1 T A 10: 10,595,307 (GRCm39) T774S probably damaging Het
Gtse1 A C 15: 85,746,340 (GRCm39) D52A probably benign Het
Kctd17 T A 15: 78,312,982 (GRCm39) F42Y probably damaging Het
Kndc1 A G 7: 139,488,878 (GRCm39) K178E probably damaging Het
Lrrc74b T C 16: 17,376,125 (GRCm39) E175G probably damaging Het
Macf1 A G 4: 123,278,661 (GRCm39) I5927T probably damaging Het
Maml2 A G 9: 13,617,191 (GRCm39) N935S probably benign Het
Man2a1 A G 17: 65,019,295 (GRCm39) I720V probably benign Het
Map3k5 C T 10: 19,899,399 (GRCm39) H219Y possibly damaging Het
Map4k5 T C 12: 69,884,787 (GRCm39) T314A possibly damaging Het
Mcmbp C T 7: 128,306,248 (GRCm39) V457I probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Nacc1 T C 8: 85,402,783 (GRCm39) I337V probably damaging Het
Nipbl T C 15: 8,359,780 (GRCm39) D1475G probably benign Het
Orc1 T A 4: 108,457,137 (GRCm39) D392E probably benign Het
Pappa2 T C 1: 158,642,355 (GRCm39) T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 (GRCm39) V51I possibly damaging Het
Ppp1r12a G A 10: 108,089,208 (GRCm39) E616K possibly damaging Het
Ptgs1 A G 2: 36,135,280 (GRCm39) M415V probably benign Het
Ralgapa2 C T 2: 146,176,414 (GRCm39) E1683K probably damaging Het
Rap2a T A 14: 120,716,406 (GRCm39) F90I probably benign Het
Rcvrn A G 11: 67,590,875 (GRCm39) E153G possibly damaging Het
Sharpin C A 15: 76,234,866 (GRCm39) probably benign Het
Skil T A 3: 31,151,647 (GRCm39) D56E probably benign Het
Slc22a18 G T 7: 143,033,082 (GRCm39) G57W probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Synj1 T C 16: 90,788,406 (GRCm39) D154G probably damaging Het
Tbc1d24 A T 17: 24,400,746 (GRCm39) N156K probably benign Het
Tcea1 A T 1: 4,950,568 (GRCm39) probably benign Het
Tmc3 T C 7: 83,261,755 (GRCm39) V611A probably damaging Het
Tnrc6c A G 11: 117,591,588 (GRCm39) M1V probably null Het
Tomm5 A T 4: 45,106,689 (GRCm39) probably benign Het
Ttc6 A G 12: 57,736,620 (GRCm39) K1207R probably null Het
Ttn T C 2: 76,591,448 (GRCm39) T12747A possibly damaging Het
Ttn A T 2: 76,715,480 (GRCm39) probably benign Het
Utrn T C 10: 12,569,175 (GRCm39) D1147G probably benign Het
Vmn1r53 T C 6: 90,200,395 (GRCm39) I310V probably benign Het
Washc4 A C 10: 83,410,386 (GRCm39) D658A probably benign Het
Wrap73 G A 4: 154,229,731 (GRCm39) R34Q probably damaging Het
Ylpm1 T C 12: 85,077,003 (GRCm39) F1243L probably benign Het
Zbtb24 T C 10: 41,340,784 (GRCm39) S605P probably benign Het
Zfy1 T G Y: 726,205 (GRCm39) H520P possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGTAATCAGGTCCTGAGCGTC -3'
(R):5'- GCCTCATTTCCCATGTGTGTAG -3'

Sequencing Primer
(F):5'- AGGTCCTGAGCGTCAAGGG -3'
(R):5'- AGCCTCATCTCCCATATGTATAGGTG -3'
Posted On 2016-09-01