Incidental Mutation 'R5428:Grm1'
ID427018
Institutional Source Beutler Lab
Gene Symbol Grm1
Ensembl Gene ENSMUSG00000019828
Gene Nameglutamate receptor, metabotropic 1
SynonymsGrm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10686059-11082356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10719563 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 774 (T774S)
Ref Sequence ENSEMBL: ENSMUSP00000101190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]
Predicted Effect probably damaging
Transcript: ENSMUST00000044306
AA Change: T774S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: T774S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105560
AA Change: T774S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: T774S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105561
AA Change: T774S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: T774S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155772
Meta Mutation Damage Score 0.3254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Grm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
dewey UTSW 10 10719595 missense probably damaging 1.00
Dingus UTSW 10 10719967 missense probably benign 0.06
donald UTSW 10 10741508 nonsense probably null
jim UTSW 10 10719805 missense probably damaging 1.00
lightness UTSW 10 11079958 missense probably damaging 1.00
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R0554:Grm1 UTSW 10 10719923 missense probably benign 0.01
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2198:Grm1 UTSW 10 10782776 missense probably damaging 1.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5152:Grm1 UTSW 10 11079875 missense probably benign 0.13
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
R7027:Grm1 UTSW 10 10719595 missense probably damaging 1.00
R7079:Grm1 UTSW 10 11079958 missense probably damaging 1.00
R7286:Grm1 UTSW 10 10689696 missense probably benign 0.19
R7352:Grm1 UTSW 10 10719493 missense probably damaging 1.00
R7484:Grm1 UTSW 10 10746659 missense probably benign 0.06
R7838:Grm1 UTSW 10 11080352 missense probably benign 0.02
R8108:Grm1 UTSW 10 10720132 missense probably benign 0.01
R8379:Grm1 UTSW 10 10689135 missense possibly damaging 0.86
R8498:Grm1 UTSW 10 11079861 nonsense probably null
R8712:Grm1 UTSW 10 10689552 missense probably benign 0.34
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACATCTTGGGAGTGAACATGC -3'
(R):5'- TTGGGCCCAAGTGATCATAG -3'

Sequencing Primer
(F):5'- TGAACATGCAGCCCAGG -3'
(R):5'- AGCCTCCATTCTGATTAGTGTACAG -3'
Posted On2016-09-01