Incidental Mutation 'R5428:Washc4'
ID427022
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83574522 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 658 (D658A)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably benign
Transcript: ENSMUST00000038388
AA Change: D658A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: D658A

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218570
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7983:Washc4 UTSW 10 83573773 splice site probably null
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCTATATCACGGGTTTCAGGG -3'
(R):5'- CATCTTCCAAAGCACTGCTC -3'

Sequencing Primer
(F):5'- GAAAGTATTTTCCCTTTAGGTCAGAG -3'
(R):5'- ATTACAGATGGTTGTGAGCCACC -3'
Posted On2016-09-01