Mutagenetix > Incidental Mutations

Incidental Mutation 'R5428:Gtse1'

427038

Institutional Source

Beutler Lab

Gene Symbol

Gtse1

Ensembl Gene

ENSMUSG00000022385

Gene Name

G two S phase expressed protein 1

Synonyms

B99, Gtse-1

MMRRC Submission

042994-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85859745-85876573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 85862139 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 52 (D52A)

Ref Sequence

ENSEMBL: ENSMUSP00000155552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146088] [ENSMUST00000170629] [ENSMUST00000231074]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133158

Predicted Effect

probably benign
Transcript: ENSMUST00000146088

SMART Domains

Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944

Domain	Start	End	E-Value	Type
SCOP:d1ld8a_	105	272	1e-7	SMART
low complexity region	342	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170629
AA Change: D52A

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: D52A

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	10	153	3e-62	PFAM
low complexity region	284	301	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC
low complexity region	478	497	N/A	INTRINSIC
low complexity region	568	593	N/A	INTRINSIC
low complexity region	644	653	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231074
AA Change: D52A

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,635,918	V324L	probably benign	Het
Abl2	T	C	1: 156,642,111	C982R	probably damaging	Het
Adgrl4	G	A	3: 151,542,686	C665Y	probably damaging	Het
Adra1d	A	G	2: 131,561,403	S256P	probably damaging	Het
Aipl1	T	A	11: 72,030,487	Y194F	probably benign	Het
Arfgef1	C	A	1: 10,160,835	D1150Y	probably damaging	Het
Arl14epl	A	T	18: 46,926,320	M1L	possibly damaging	Het
Colgalt1	G	T	8: 71,622,776	R442L	probably damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dach1	A	G	14: 98,169,269	V14A	unknown	Het
Defa30	A	G	8: 21,135,403	D61G	probably benign	Het
Dnaja2	A	T	8: 85,540,175	C308S	probably benign	Het
Emc4	A	G	2: 112,367,355		probably benign	Het
Foxp1	A	G	6: 99,016,631	V104A	probably damaging	Het
Fry	T	G	5: 150,405,359	L1319R	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gja10	T	A	4: 32,601,169	H405L	probably benign	Het
Gm27047	A	G	6: 130,630,564		noncoding transcript	Het
Grm1	T	A	10: 10,719,563	T774S	probably damaging	Het
Kctd17	T	A	15: 78,428,782	F42Y	probably damaging	Het
Kndc1	A	G	7: 139,908,962	K178E	probably damaging	Het
Lrrc74b	T	C	16: 17,558,261	E175G	probably damaging	Het
Macf1	A	G	4: 123,384,868	I5927T	probably damaging	Het
Maml2	A	G	9: 13,705,895	N935S	probably benign	Het
Man2a1	A	G	17: 64,712,300	I720V	probably benign	Het
Map3k5	C	T	10: 20,023,653	H219Y	possibly damaging	Het
Map4k5	T	C	12: 69,838,013	T314A	possibly damaging	Het
Mast3	A	G	8: 70,784,733	V615A	possibly damaging	Het
Mcmbp	C	T	7: 128,704,524	V457I	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nacc1	T	C	8: 84,676,154	I337V	probably damaging	Het
Nipbl	T	C	15: 8,330,296	D1475G	probably benign	Het
Orc1	T	A	4: 108,599,940	D392E	probably benign	Het
Pappa2	T	C	1: 158,814,785	T1297A	possibly damaging	Het
Plag1	C	T	4: 3,905,538	V51I	possibly damaging	Het
Ppp1r12a	G	A	10: 108,253,347	E616K	possibly damaging	Het
Ptgs1	A	G	2: 36,245,268	M415V	probably benign	Het
Ralgapa2	C	T	2: 146,334,494	E1683K	probably damaging	Het
Rap2a	T	A	14: 120,478,994	F90I	probably benign	Het
Rcvrn	A	G	11: 67,700,049	E153G	possibly damaging	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skil	T	A	3: 31,097,498	D56E	probably benign	Het
Slc22a18	G	T	7: 143,479,345	G57W	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Synj1	T	C	16: 90,991,518	D154G	probably damaging	Het
Tbc1d24	A	T	17: 24,181,772	N156K	probably benign	Het
Tcea1	A	T	1: 4,880,345		probably benign	Het
Tmc3	T	C	7: 83,612,547	V611A	probably damaging	Het
Tnrc6c	A	G	11: 117,700,762	M1V	probably null	Het
Tomm5	A	T	4: 45,106,689		probably benign	Het
Ttc6	A	G	12: 57,689,834	K1207R	probably null	Het
Ttn	T	C	2: 76,761,104	T12747A	possibly damaging	Het
Ttn	A	T	2: 76,885,136		probably benign	Het
Utrn	T	C	10: 12,693,431	D1147G	probably benign	Het
Vmn1r53	T	C	6: 90,223,413	I310V	probably benign	Het
Washc4	A	C	10: 83,574,522	D658A	probably benign	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Ylpm1	T	C	12: 85,030,229	F1243L	probably benign	Het
Zbtb24	T	C	10: 41,464,788	S605P	probably benign	Het
Zfy1	T	G	Y: 726,205	H520P	possibly damaging	Het

Other mutations in Gtse1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Gtse1	APN	15	85868817	missense	possibly damaging	0.54
IGL01344:Gtse1	APN	15	85862066	critical splice acceptor site	probably null
IGL01541:Gtse1	APN	15	85875654	nonsense	probably null
IGL01621:Gtse1	APN	15	85875082	missense	probably benign	0.01
IGL01945:Gtse1	APN	15	85871547	missense	probably benign	0.00
IGL02193:Gtse1	APN	15	85862330	missense	probably benign	0.27
IGL02215:Gtse1	APN	15	85862598	missense	possibly damaging	0.92
IGL02494:Gtse1	APN	15	85867503	missense	probably damaging	1.00
IGL02879:Gtse1	APN	15	85869063	splice site	probably benign
R0009:Gtse1	UTSW	15	85862435	missense	probably benign	0.06
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0576:Gtse1	UTSW	15	85869051	missense	probably damaging	1.00
R1078:Gtse1	UTSW	15	85862307	missense	probably damaging	0.98
R1442:Gtse1	UTSW	15	85860102	splice site	probably benign
R1623:Gtse1	UTSW	15	85867578	missense	probably benign
R1925:Gtse1	UTSW	15	85873738	missense	probably benign	0.00
R1928:Gtse1	UTSW	15	85862063	splice site	probably benign
R4565:Gtse1	UTSW	15	85875184	missense	probably damaging	0.99
R5170:Gtse1	UTSW	15	85864264	critical splice donor site	probably null
R5310:Gtse1	UTSW	15	85873792	missense	probably benign	0.04
R5748:Gtse1	UTSW	15	85867577	missense	probably benign
R5996:Gtse1	UTSW	15	85864180	missense	probably benign	0.00
R6179:Gtse1	UTSW	15	85868957	missense	possibly damaging	0.95
R6379:Gtse1	UTSW	15	85864224	missense	probably benign	0.01
R6381:Gtse1	UTSW	15	85862148	missense	probably benign	0.00
R6434:Gtse1	UTSW	15	85875169	missense	probably benign	0.21
R7086:Gtse1	UTSW	15	85875549	missense	probably damaging	1.00
R7304:Gtse1	UTSW	15	85871547	missense	probably benign	0.00
R7485:Gtse1	UTSW	15	85868700	missense	probably benign	0.04
R7580:Gtse1	UTSW	15	85862231	missense	probably damaging	1.00
R7856:Gtse1	UTSW	15	85864141	missense	probably benign	0.09
R8496:Gtse1	UTSW	15	85862082	missense	probably damaging	1.00
R8674:Gtse1	UTSW	15	85862175	missense	probably damaging	1.00
Z1176:Gtse1	UTSW	15	85868746	missense	possibly damaging	0.85
Z1177:Gtse1	UTSW	15	85875737	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CAAGGTAAACATGCGTTTTCTTCC -3'
(R):5'- TGTGAGTCCTGCACAAACG -3'

Sequencing Primer
(F):5'- CCTAACCCCTGGTATAGACAGGTTC -3'
(R):5'- GTGAGTCCTGCACAAACGTTTCC -3'

Posted On

2016-09-01