Mutagenetix > Incidental Mutation

Incidental Mutation 'R5429:Vil1'

427046

Institutional Source

Beutler Lab

Gene Symbol

Vil1

Ensembl Gene

ENSMUSG00000026175

Gene Name

villin 1

Synonyms

MMRRC Submission

042995-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74409376-74435559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 74432331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 757 (T757I)

Ref Sequence

ENSEMBL: ENSMUSP00000027366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027366] [ENSMUST00000044260]

AlphaFold

Q62468

Predicted Effect

probably benign
Transcript: ENSMUST00000027366
AA Change: T757I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: T757I

Domain	Start	End	E-Value	Type
GEL	17	114	2.93e-29	SMART
GEL	135	229	1.33e-18	SMART
GEL	251	349	5.85e-29	SMART
GEL	398	495	1.44e-28	SMART
GEL	515	601	7.31e-30	SMART
GEL	620	714	1.36e-29	SMART
VHP	792	827	1.77e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000044260

SMART Domains

Protein: ENSMUSP00000035445
Gene: ENSMUSG00000033364

Domain	Start	End	E-Value	Type
Pfam:UCH_N	1	105	5.1e-47	PFAM
low complexity region	182	200	N/A	INTRINSIC
Pfam:UCH_1	341	645	3.4e-16	PFAM
UIM	704	723	1.33e1	SMART
UIM	806	825	1.04e-1	SMART
UIM	828	847	2.11e-2	SMART
low complexity region	893	909	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Vil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Vil1	APN	1	74423875	missense	probably damaging	1.00
IGL00703:Vil1	APN	1	74423960	missense	possibly damaging	0.61
IGL01011:Vil1	APN	1	74434887	splice site	probably null
IGL01314:Vil1	APN	1	74428238	missense	probably damaging	1.00
IGL01772:Vil1	APN	1	74415119	missense	probably benign
IGL02378:Vil1	APN	1	74430691	splice site	probably null
IGL02517:Vil1	APN	1	74426692	missense	probably benign	0.43
IGL02955:Vil1	APN	1	74418523	missense	probably benign	0.10
IGL03036:Vil1	APN	1	74419612	missense	probably damaging	1.00
PIT4362001:Vil1	UTSW	1	74421383	missense	probably damaging	1.00
R0104:Vil1	UTSW	1	74418366	missense	probably benign	0.44
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0496:Vil1	UTSW	1	74421340	missense	possibly damaging	0.88
R1329:Vil1	UTSW	1	74427558	missense	probably benign	0.00
R1824:Vil1	UTSW	1	74418447	missense	probably benign	0.00
R1916:Vil1	UTSW	1	74418525	missense	probably benign
R2188:Vil1	UTSW	1	74427565	missense	probably benign	0.22
R2216:Vil1	UTSW	1	74425679	missense	probably benign	0.05
R3808:Vil1	UTSW	1	74427613	missense	probably benign
R3939:Vil1	UTSW	1	74432415	missense	probably benign	0.09
R4288:Vil1	UTSW	1	74418525	missense	probably benign
R4648:Vil1	UTSW	1	74432298	missense	probably benign
R4748:Vil1	UTSW	1	74421266	missense	probably damaging	1.00
R5333:Vil1	UTSW	1	74432390	missense	probably benign
R5973:Vil1	UTSW	1	74416033	missense	possibly damaging	0.93
R6007:Vil1	UTSW	1	74419867	missense	probably damaging	1.00
R6247:Vil1	UTSW	1	74432339	missense	probably benign
R6306:Vil1	UTSW	1	74421311	missense	possibly damaging	0.90
R6989:Vil1	UTSW	1	74423954	missense	probably damaging	0.99
R7112:Vil1	UTSW	1	74416002	missense	probably damaging	1.00
R7320:Vil1	UTSW	1	74418444	missense	probably damaging	1.00
R7481:Vil1	UTSW	1	74419899	missense	probably damaging	1.00
R7553:Vil1	UTSW	1	74426732	critical splice donor site	probably null
R7709:Vil1	UTSW	1	74426595	missense	probably benign	0.39
R7791:Vil1	UTSW	1	74428136	missense	probably damaging	1.00
R8159:Vil1	UTSW	1	74423977	missense	probably benign	0.00
R8190:Vil1	UTSW	1	74434893	nonsense	probably null
R9650:Vil1	UTSW	1	74425616	missense	probably benign	0.32
R9679:Vil1	UTSW	1	74430674	missense	probably benign	0.00
R9734:Vil1	UTSW	1	74415150	missense	possibly damaging	0.46
Z1176:Vil1	UTSW	1	74428232	missense	probably damaging	0.98
Z1177:Vil1	UTSW	1	74415132	missense	probably damaging	1.00
Z1177:Vil1	UTSW	1	74421430	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGACTTAGGCCAGTTGCAG -3'
(R):5'- GGCACAGTCTGAGGTTATTAGG -3'

Sequencing Primer
(F):5'- CTAGGCTATTAGCTTTTGGGTCCAAC -3'
(R):5'- GGTTTTCTAATAACATGGACCAGACC -3'

Posted On

2016-09-01