Incidental Mutation 'R5429:Ctnnd1'
ID427048
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Namecatenin (cadherin associated protein), delta 1
SynonymsP120, p120-catenin, Ctnnd, Catns
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84600071-84650765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84616789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 371 (V371M)
Ref Sequence ENSEMBL: ENSMUSP00000141166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111688] [ENSMUST00000111689] [ENSMUST00000111690] [ENSMUST00000111691] [ENSMUST00000111692] [ENSMUST00000111693] [ENSMUST00000111694] [ENSMUST00000111695] [ENSMUST00000111696] [ENSMUST00000111697] [ENSMUST00000111698] [ENSMUST00000189772]
Predicted Effect probably damaging
Transcript: ENSMUST00000036811
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066177
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067232
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099941
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111670
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111675
AA Change: V48M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101
AA Change: V48M

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111676
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111677
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111678
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111684
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111685
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111686
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111687
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111688
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111689
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111690
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111691
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111692
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111693
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111694
AA Change: V371M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111695
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111696
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111697
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111698
AA Change: V307M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: V307M

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145312
Predicted Effect probably damaging
Transcript: ENSMUST00000189772
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Meta Mutation Damage Score 0.7603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84609625 missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84622010 critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84603752 missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84605256 splice site probably benign
IGL02035:Ctnnd1 APN 2 84620081 missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84605196 missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84619909 splice site probably benign
IGL03270:Ctnnd1 APN 2 84609727 splice site probably null
IGL02802:Ctnnd1 UTSW 2 84624462 start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84603262 missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84609067 missense probably damaging 1.00
R0652:Ctnnd1 UTSW 2 84602896 missense probably benign 0.40
R1503:Ctnnd1 UTSW 2 84605179 splice site probably null
R1701:Ctnnd1 UTSW 2 84608991 missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84615209 missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84612548 missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84609563 missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84616680 missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84624271 missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84616927 missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84619958 missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84603701 missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84619926 missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84622052 nonsense probably null
R4964:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R4966:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R5223:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5336:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84620915 nonsense probably null
R6018:Ctnnd1 UTSW 2 84650468 intron probably benign
R6285:Ctnnd1 UTSW 2 84613887 critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84624308 missense probably benign
R6661:Ctnnd1 UTSW 2 84609642 missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84624505 start gained probably benign
R6769:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6916:Ctnnd1 UTSW 2 84609646 missense probably benign 0.02
R7025:Ctnnd1 UTSW 2 84610606 missense possibly damaging 0.82
R7208:Ctnnd1 UTSW 2 84622046 missense possibly damaging 0.48
R7466:Ctnnd1 UTSW 2 84610785 missense probably benign 0.30
R7583:Ctnnd1 UTSW 2 84612061 missense probably damaging 0.99
X0062:Ctnnd1 UTSW 2 84615214 missense probably damaging 1.00
Z1177:Ctnnd1 UTSW 2 84615172 missense not run
Predicted Primers PCR Primer
(F):5'- TTCTTGAGAGCTCCACAGGC -3'
(R):5'- TGGTAATAGGAATGTCTATGAAGCCAG -3'

Sequencing Primer
(F):5'- AGGCTCCGAGGTGCACTTC -3'
(R):5'- GAAGCCAGATTTAACTGCTTGG -3'
Posted On2016-09-01