Incidental Mutation 'R5429:Kat14'
ID427049
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Namelysine acetyltransferase 14
SynonymsD2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission 042995-MU
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144368983-144407676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144393323 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 234 (D234E)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
Predicted Effect probably benign
Transcript: ENSMUST00000028911
AA Change: D234E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: D234E

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143318
Predicted Effect probably benign
Transcript: ENSMUST00000147747
AA Change: D23E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425
AA Change: D23E

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTTCTGTGTATTGAACATGATACC -3'
(R):5'- GGCTTATGAACTTGACGGGG -3'

Sequencing Primer
(F):5'- CTGTATCCAGCTCCAGAAAATGTGG -3'
(R):5'- GGGTGGAAGAGGTGCTCC -3'
Posted On2016-09-01