Incidental Mutation 'R5429:Gm10770'
ID427050
Institutional Source Beutler Lab
Gene Symbol Gm10770
Ensembl Gene ENSMUSG00000074837
Gene Namepredicted gene 10770
Synonyms
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150178882-150179679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150179423 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 58 (R58H)
Ref Sequence ENSEMBL: ENSMUSP00000097015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099418] [ENSMUST00000109926]
Predicted Effect probably benign
Transcript: ENSMUST00000099418
AA Change: R58H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097015
Gene: ENSMUSG00000074837
AA Change: R58H

DomainStartEndE-ValueType
ZnF_C2H2 12 34 8.09e0 SMART
ZnF_C2H2 40 62 8.4e1 SMART
ZnF_C2H2 68 90 1.12e-3 SMART
ZnF_C2H2 96 118 3.47e1 SMART
ZnF_C2H2 124 146 1.09e2 SMART
ZnF_C2H2 152 174 3.58e-2 SMART
ZnF_C2H2 180 202 6.23e-2 SMART
ZnF_C2H2 208 230 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109926
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Gm10770
AlleleSourceChrCoordTypePredicted EffectPPH Score
F5770:Gm10770 UTSW 2 150179484 nonsense probably null
R1765:Gm10770 UTSW 2 150179338 missense probably damaging 1.00
R1842:Gm10770 UTSW 2 150179156 missense probably damaging 1.00
R3438:Gm10770 UTSW 2 150179549 unclassified probably null
R4564:Gm10770 UTSW 2 150178911 missense probably benign 0.00
R4863:Gm10770 UTSW 2 150178896 nonsense probably null
R5134:Gm10770 UTSW 2 150179560 splice site probably null
R5424:Gm10770 UTSW 2 150179028 missense probably benign 0.01
R5976:Gm10770 UTSW 2 150179400 nonsense probably null
R6436:Gm10770 UTSW 2 150178910 missense probably benign 0.07
R6679:Gm10770 UTSW 2 150179649 missense probably damaging 1.00
V7580:Gm10770 UTSW 2 150179484 nonsense probably null
V7581:Gm10770 UTSW 2 150179484 nonsense probably null
V7583:Gm10770 UTSW 2 150179484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGATGACACTCATAGGGTTTCC -3'
(R):5'- GGAGAAAGCCTATGTATTTCAGAGTC -3'

Sequencing Primer
(F):5'- GGGTTTCCCTCCTGTATGCG -3'
(R):5'- GTGTCCAACATTGTGAAGCC -3'
Posted On2016-09-01