Incidental Mutation 'R5429:Ankrd34a'
ID427054
Institutional Source Beutler Lab
Gene Symbol Ankrd34a
Ensembl Gene ENSMUSG00000049097
Gene Nameankyrin repeat domain 34A
SynonymsAnkrd34
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96596636-96599775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96597521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 14 (G14R)
Ref Sequence ENSEMBL: ENSMUSP00000102707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058943] [ENSMUST00000062058] [ENSMUST00000091924] [ENSMUST00000145001]
Predicted Effect probably damaging
Transcript: ENSMUST00000058943
AA Change: G14R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102707
Gene: ENSMUSG00000049097
AA Change: G14R

DomainStartEndE-ValueType
ANK 4 33 9.05e2 SMART
ANK 37 72 2.81e-4 SMART
ANK 76 106 5.84e-2 SMART
ANK 110 139 7.99e2 SMART
low complexity region 216 244 N/A INTRINSIC
low complexity region 350 366 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091924
SMART Domains Protein: ENSMUSP00000089544
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 217 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145001
SMART Domains Protein: ENSMUSP00000118943
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 148 4.4e-31 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Ankrd34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Ankrd34a APN 3 96598913 missense probably benign 0.33
R0190:Ankrd34a UTSW 3 96597789 missense probably damaging 0.99
R1940:Ankrd34a UTSW 3 96598676 missense probably benign 0.28
R3779:Ankrd34a UTSW 3 96598931 missense possibly damaging 0.85
R5427:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5430:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R6129:Ankrd34a UTSW 3 96597958 nonsense probably null
R6621:Ankrd34a UTSW 3 96598215 missense possibly damaging 0.91
R6891:Ankrd34a UTSW 3 96598019 missense probably benign 0.00
R6951:Ankrd34a UTSW 3 96598422 missense possibly damaging 0.77
R7085:Ankrd34a UTSW 3 96598629 missense probably benign
R7478:Ankrd34a UTSW 3 96598500 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TTCGTTCATCGGTGCCTCAG -3'
(R):5'- TAAACGGTCTGCGATGTTGG -3'

Sequencing Primer
(F):5'- CTGAGCCTGTCAGTAAGCTC -3'
(R):5'- CTGCGATGTTGGGATCCGC -3'
Posted On2016-09-01