Incidental Mutation 'R5429:Csde1'
ID427055
Institutional Source Beutler Lab
Gene Symbol Csde1
Ensembl Gene ENSMUSG00000068823
Gene Namecold shock domain containing E1, RNA binding
Synonymsunr, D3Jfr1
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103020426-103058186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103052841 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 564 (T564A)
Ref Sequence ENSEMBL: ENSMUSP00000143028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029446] [ENSMUST00000197488] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199240] [ENSMUST00000199420] [ENSMUST00000199571]
Predicted Effect probably benign
Transcript: ENSMUST00000029446
AA Change: T595A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823
AA Change: T595A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196685
Predicted Effect possibly damaging
Transcript: ENSMUST00000197488
AA Change: T564A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823
AA Change: T564A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197827
AA Change: T595A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823
AA Change: T595A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197844
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect possibly damaging
Transcript: ENSMUST00000198180
AA Change: T564A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823
AA Change: T564A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199240
AA Change: T465A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823
AA Change: T465A

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199420
AA Change: T564A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823
AA Change: T564A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199571
AA Change: T564A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823
AA Change: T564A

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Csde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Csde1 APN 3 103040525 missense possibly damaging 0.80
IGL01419:Csde1 APN 3 103038770 missense probably damaging 1.00
IGL02147:Csde1 APN 3 103039934 missense probably damaging 1.00
IGL02161:Csde1 APN 3 103050338 missense probably damaging 0.99
IGL02442:Csde1 APN 3 103054819 missense probably benign 0.20
IGL03036:Csde1 APN 3 103043839 missense probably damaging 0.99
R0526:Csde1 UTSW 3 103056426 missense possibly damaging 0.76
R0727:Csde1 UTSW 3 103043638 missense probably benign
R1738:Csde1 UTSW 3 103029177 intron probably benign
R1744:Csde1 UTSW 3 103050315 missense probably benign 0.31
R2007:Csde1 UTSW 3 103044791 missense probably damaging 1.00
R4665:Csde1 UTSW 3 103047072 missense probably damaging 1.00
R4806:Csde1 UTSW 3 103056369 unclassified probably benign
R5202:Csde1 UTSW 3 103039934 missense probably damaging 1.00
R5298:Csde1 UTSW 3 103047209 intron probably null
R5896:Csde1 UTSW 3 103040543 intron probably benign
R6076:Csde1 UTSW 3 103041229 missense possibly damaging 0.82
R6093:Csde1 UTSW 3 103052902 missense probably damaging 1.00
R6118:Csde1 UTSW 3 103054754 missense probably benign 0.45
R6213:Csde1 UTSW 3 103040514 missense probably damaging 1.00
R6263:Csde1 UTSW 3 103040017 missense probably benign 0.05
R6653:Csde1 UTSW 3 103052868 missense probably damaging 1.00
R6894:Csde1 UTSW 3 103044656 missense possibly damaging 0.56
R7155:Csde1 UTSW 3 103039953 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCATTGCAGAGTCATTGCATAAC -3'
(R):5'- GTCTATAGAACTAAAGCCTAAGCACAG -3'

Sequencing Primer
(F):5'- CACCTTGTGCGAACATT -3'
(R):5'- TCTGCTCCTAAGACACCTGAAG -3'
Posted On2016-09-01