Incidental Mutation 'R5429:Slc30a7'
ID427057
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Namesolute carrier family 30 (zinc transporter), member 7
Synonyms2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location115938973-116007406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116006925 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000065254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029575] [ENSMUST00000067485] [ENSMUST00000106501] [ENSMUST00000106502]
Predicted Effect probably benign
Transcript: ENSMUST00000029575
SMART Domains Protein: ENSMUSP00000029575
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 8.5e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067485
AA Change: S31P

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: S31P

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106501
SMART Domains Protein: ENSMUSP00000102110
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_transf_64 53 307 1.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106502
SMART Domains Protein: ENSMUSP00000102111
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 1.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R2445:Slc30a7 UTSW 3 115978653 missense probably damaging 1.00
R4072:Slc30a7 UTSW 3 115946680 missense probably damaging 0.96
R4850:Slc30a7 UTSW 3 115993008 missense probably damaging 0.99
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAGCTACGTGGCACTAAG -3'
(R):5'- AAGATCTCAGGCTGGTTTAGG -3'

Sequencing Primer
(F):5'- AAGCAAATAGTGGCTTGTCTCCC -3'
(R):5'- CAGGCTGGTTTAGGTGCGG -3'
Posted On2016-09-01