Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Slc30a7'

427057

Institutional Source

Beutler Lab

Gene Symbol

Slc30a7

Ensembl Gene

ENSMUSG00000054414

Gene Name

solute carrier family 30 (zinc transporter), member 7

Synonyms

2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.554) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115938973-116007406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116006925 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 31 (S31P)

Ref Sequence

ENSEMBL: ENSMUSP00000065254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029575] [ENSMUST00000067485] [ENSMUST00000106501] [ENSMUST00000106502]

Predicted Effect

probably benign
Transcript: ENSMUST00000029575

SMART Domains

Protein: ENSMUSP00000029575
Gene: ENSMUSG00000027963

Domain	Start	End	E-Value	Type
low complexity region	19	41	N/A	INTRINSIC
Pfam:Glyco_transf_64	67	321	8.5e-88	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067485
AA Change: S31P

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: S31P

Domain	Start	End	E-Value	Type
Pfam:Cation_efflux	38	296	3.3e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106501

SMART Domains

Protein: ENSMUSP00000102110
Gene: ENSMUSG00000027963

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_transf_64	53	307	1.7e-86	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106502

SMART Domains

Protein: ENSMUSP00000102111
Gene: ENSMUSG00000027963

Domain	Start	End	E-Value	Type
low complexity region	19	41	N/A	INTRINSIC
Pfam:Glyco_transf_64	67	321	1.4e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145945

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149920

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Slc30a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Slc30a7	APN	3	115946720	splice site	probably null
IGL01161:Slc30a7	APN	3	115954110	missense	possibly damaging	0.54
IGL01360:Slc30a7	APN	3	115990116	missense	probably damaging	1.00
IGL02573:Slc30a7	APN	3	115990147	splice site	probably benign
R0833:Slc30a7	UTSW	3	115990140	critical splice acceptor site	probably null
R0836:Slc30a7	UTSW	3	115990140	critical splice acceptor site	probably null
R1381:Slc30a7	UTSW	3	115956870	critical splice donor site	probably null
R2445:Slc30a7	UTSW	3	115978653	missense	probably damaging	1.00
R4072:Slc30a7	UTSW	3	115946680	missense	probably damaging	0.96
R4850:Slc30a7	UTSW	3	115993008	missense	probably damaging	0.99
R5586:Slc30a7	UTSW	3	115990051	missense	probably benign	0.36
R6170:Slc30a7	UTSW	3	115990743	missense	probably damaging	1.00
R6813:Slc30a7	UTSW	3	115981811	missense	probably benign	0.01
R6889:Slc30a7	UTSW	3	115954153	missense	probably damaging	1.00
X0023:Slc30a7	UTSW	3	115990025	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGAGCTACGTGGCACTAAG -3'
(R):5'- AAGATCTCAGGCTGGTTTAGG -3'

Sequencing Primer
(F):5'- AAGCAAATAGTGGCTTGTCTCCC -3'
(R):5'- CAGGCTGGTTTAGGTGCGG -3'

Posted On

2016-09-01