Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Nfx1'

427060

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41004343 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 705 (C705R)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030133
AA Change: C705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: C705R

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091614
AA Change: C705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: C705R

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098143
AA Change: C705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: C705R

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124595

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143798

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATTCGAGCTGTACAGTGAGG -3'
(R):5'- GATTGCTCAAAGTTTCTAGGAACC -3'

Sequencing Primer
(F):5'- AGGGAGTGCTCTGCTCAGTC -3'
(R):5'- GCTCTGGCTACAAGTAGTCCTG -3'

Posted On

2016-09-01