Incidental Mutation 'R5429:Zfp462'
ID427061
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55060077 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1201 (V1201A)
Ref Sequence ENSEMBL: ENSMUSP00000078555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070]
Predicted Effect probably damaging
Transcript: ENSMUST00000030131
AA Change: V1200A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206
AA Change: V1200A

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079605
AA Change: V1201A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206
AA Change: V1201A

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098070
AA Change: V2288A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: V2288A

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55008908 missense probably benign
R7741:Zfp462 UTSW 4 55008637 missense probably benign 0.00
R7750:Zfp462 UTSW 4 55016958 missense probably benign 0.06
R7812:Zfp462 UTSW 4 55008509 missense probably benign 0.00
R7863:Zfp462 UTSW 4 55007747 missense probably benign
R7898:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7946:Zfp462 UTSW 4 55007747 missense probably benign
R7981:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7995:Zfp462 UTSW 4 55011907 missense not run
R8023:Zfp462 UTSW 4 55073106 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TGGTCTTCCACATACCCAGTTG -3'
(R):5'- GGGTAAGTACCTTGTGCTCATC -3'

Sequencing Primer
(F):5'- CCACATACCCAGTTGTGCTG -3'
(R):5'- AAGTACCTTGTGCTCATCCCGAAG -3'
Posted On2016-09-01