Incidental Mutation 'R5429:Olfr60'
ID427070
Institutional Source Beutler Lab
Gene Symbol Olfr60
Ensembl Gene ENSMUSG00000060112
Gene Nameolfactory receptor 60
SynonymsIH6, GA_x6K02T2PBJ9-42496183-42495251, MOR253-6
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140343815-140361671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140345273 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 239 (F239L)
Ref Sequence ENSEMBL: ENSMUSP00000150685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075470] [ENSMUST00000210932] [ENSMUST00000211031] [ENSMUST00000215023] [ENSMUST00000216027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075470
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074916
Gene: ENSMUSG00000060112
AA Change: F239L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.2e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 161 1.8e-8 PFAM
Pfam:7tm_1 42 291 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209726
Predicted Effect possibly damaging
Transcript: ENSMUST00000210932
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211031
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211655
Predicted Effect possibly damaging
Transcript: ENSMUST00000215023
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216027
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Olfr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Olfr60 APN 7 140345210 missense probably damaging 1.00
IGL03493:Olfr60 APN 7 140345153 missense probably damaging 1.00
R0413:Olfr60 UTSW 7 140345195 missense possibly damaging 0.94
R0652:Olfr60 UTSW 7 140345632 missense probably damaging 1.00
R1848:Olfr60 UTSW 7 140345987 start codon destroyed probably benign
R1908:Olfr60 UTSW 7 140345465 missense probably benign 0.05
R1909:Olfr60 UTSW 7 140345465 missense probably benign 0.05
R5133:Olfr60 UTSW 7 140345323 missense probably damaging 1.00
R5320:Olfr60 UTSW 7 140345635 missense probably benign 0.00
R6595:Olfr60 UTSW 7 140345647 missense probably damaging 1.00
R6621:Olfr60 UTSW 7 140345455 missense probably damaging 1.00
R7300:Olfr60 UTSW 7 140345355 missense probably damaging 1.00
R7409:Olfr60 UTSW 7 140345405 missense probably benign 0.00
R7562:Olfr60 UTSW 7 140345230 missense probably damaging 1.00
R7646:Olfr60 UTSW 7 140345951 missense probably damaging 1.00
Z1088:Olfr60 UTSW 7 140345804 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GCGAGCTTGACATCTTTGTTC -3'
(R):5'- TGTCATTCTGTGGACCCAAG -3'

Sequencing Primer
(F):5'- TCCTCAATGTGTAAATGAGGGG -3'
(R):5'- AAGGTCATCACCCACTTCTTCTGTG -3'
Posted On2016-09-01