Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Olfr60'

427070

Institutional Source

Beutler Lab

Gene Symbol

Olfr60

Ensembl Gene

ENSMUSG00000060112

Gene Name

olfactory receptor 60

Synonyms

IH6, GA_x6K02T2PBJ9-42496183-42495251, MOR253-6

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140343815-140361671 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140345273 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 239 (F239L)

Ref Sequence

ENSEMBL: ENSMUSP00000150685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075470] [ENSMUST00000210932] [ENSMUST00000211031] [ENSMUST00000215023] [ENSMUST00000216027]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075470
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074916
Gene: ENSMUSG00000060112
AA Change: F239L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	1.2e-50	PFAM
Pfam:7TM_GPCR_Srsx	36	161	1.8e-8	PFAM
Pfam:7tm_1	42	291	2e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209726

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210932
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211031
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211655

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215023
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216027
AA Change: F239L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Olfr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Olfr60	APN	7	140345210	missense	probably damaging	1.00
IGL03493:Olfr60	APN	7	140345153	missense	probably damaging	1.00
R0413:Olfr60	UTSW	7	140345195	missense	possibly damaging	0.94
R0652:Olfr60	UTSW	7	140345632	missense	probably damaging	1.00
R1848:Olfr60	UTSW	7	140345987	start codon destroyed	probably benign
R1908:Olfr60	UTSW	7	140345465	missense	probably benign	0.05
R1909:Olfr60	UTSW	7	140345465	missense	probably benign	0.05
R5133:Olfr60	UTSW	7	140345323	missense	probably damaging	1.00
R5320:Olfr60	UTSW	7	140345635	missense	probably benign	0.00
R6595:Olfr60	UTSW	7	140345647	missense	probably damaging	1.00
R6621:Olfr60	UTSW	7	140345455	missense	probably damaging	1.00
R7300:Olfr60	UTSW	7	140345355	missense	probably damaging	1.00
R7409:Olfr60	UTSW	7	140345405	missense	probably benign	0.00
R7562:Olfr60	UTSW	7	140345230	missense	probably damaging	1.00
R7646:Olfr60	UTSW	7	140345951	missense	probably damaging	1.00
R8158:Olfr60	UTSW	7	140345249	missense	probably benign	0.03
R8233:Olfr60	UTSW	7	140345498	missense	probably benign	0.01
R8238:Olfr60	UTSW	7	140345890	missense	probably damaging	1.00
R8338:Olfr60	UTSW	7	140345393	missense	probably benign	0.00
Z1088:Olfr60	UTSW	7	140345804	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- GCGAGCTTGACATCTTTGTTC -3'
(R):5'- TGTCATTCTGTGGACCCAAG -3'

Sequencing Primer
(F):5'- TCCTCAATGTGTAAATGAGGGG -3'
(R):5'- AAGGTCATCACCCACTTCTTCTGTG -3'

Posted On

2016-09-01