Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Trpc6'

427071

Institutional Source

Beutler Lab

Gene Symbol

Trpc6

Ensembl Gene

ENSMUSG00000031997

Gene Name

transient receptor potential cation channel, subfamily C, member 6

Synonyms

mtrp6, Trrp6

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8544142-8680741 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 8634074 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 385 (Q385*)

Ref Sequence

ENSEMBL: ENSMUSP00000149686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596]

Predicted Effect

probably null
Transcript: ENSMUST00000050433
AA Change: Q385*

SMART Domains

Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: Q385*

Domain	Start	End	E-Value	Type
low complexity region	37	54	N/A	INTRINSIC
ANK	96	125	4.73e2	SMART
ANK	131	159	3.49e0	SMART
ANK	217	246	6.61e-1	SMART
Pfam:TRP_2	252	314	4e-29	PFAM
transmembrane domain	406	427	N/A	INTRINSIC
Pfam:Ion_trans	442	738	4.2e-38	PFAM
Pfam:PKD_channel	477	733	3.1e-16	PFAM
low complexity region	770	781	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000214596
AA Change: Q385*

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Trpc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Trpc6	APN	9	8680438	missense	probably damaging	1.00
IGL00469:Trpc6	APN	9	8626701	missense	probably benign
IGL00970:Trpc6	APN	9	8653151	missense	probably damaging	1.00
IGL01299:Trpc6	APN	9	8653061	missense	probably damaging	1.00
IGL01563:Trpc6	APN	9	8656603	missense	probably damaging	1.00
IGL01578:Trpc6	APN	9	8634057	missense	probably damaging	1.00
IGL02657:Trpc6	APN	9	8643601	missense	possibly damaging	0.94
IGL02735:Trpc6	APN	9	8655338	missense	probably damaging	1.00
IGL03102:Trpc6	APN	9	8649301	missense	probably benign	0.07
P0038:Trpc6	UTSW	9	8649511	missense	possibly damaging	0.52
PIT4531001:Trpc6	UTSW	9	8610148	missense	probably benign	0.14
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8610275	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8643536	missense	probably damaging	1.00
R0334:Trpc6	UTSW	9	8610343	missense	probably damaging	1.00
R0665:Trpc6	UTSW	9	8634122	missense	probably benign	0.11
R0948:Trpc6	UTSW	9	8610415	missense	possibly damaging	0.60
R1177:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1217:Trpc6	UTSW	9	8658286	intron	probably null
R1445:Trpc6	UTSW	9	8680537	missense	probably benign	0.00
R1452:Trpc6	UTSW	9	8653147	missense	probably damaging	0.99
R1494:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1501:Trpc6	UTSW	9	8610169	missense	probably damaging	0.99
R1933:Trpc6	UTSW	9	8656545	missense	probably damaging	1.00
R2112:Trpc6	UTSW	9	8656612	missense	probably damaging	1.00
R2164:Trpc6	UTSW	9	8610465	nonsense	probably null
R2921:Trpc6	UTSW	9	8653033	missense	possibly damaging	0.94
R2995:Trpc6	UTSW	9	8544466	missense	probably benign	0.30
R3821:Trpc6	UTSW	9	8610278	missense	probably damaging	1.00
R3965:Trpc6	UTSW	9	8626621	missense	probably damaging	1.00
R4360:Trpc6	UTSW	9	8610266	missense	probably benign	0.10
R4625:Trpc6	UTSW	9	8677962	missense	probably benign	0.40
R4691:Trpc6	UTSW	9	8652978	missense	probably damaging	1.00
R4736:Trpc6	UTSW	9	8609870	missense	probably damaging	1.00
R4767:Trpc6	UTSW	9	8643686	missense	probably damaging	1.00
R4773:Trpc6	UTSW	9	8609851	missense	possibly damaging	0.78
R4792:Trpc6	UTSW	9	8626614	missense	probably benign	0.00
R5105:Trpc6	UTSW	9	8649470	missense	probably benign
R5319:Trpc6	UTSW	9	8609921	missense	probably damaging	1.00
R5505:Trpc6	UTSW	9	8626735	missense	probably damaging	1.00
R5657:Trpc6	UTSW	9	8609807	missense	probably benign	0.11
R5684:Trpc6	UTSW	9	8653128	missense	probably damaging	1.00
R5722:Trpc6	UTSW	9	8680549	missense	possibly damaging	0.88
R6210:Trpc6	UTSW	9	8656730	missense	probably benign	0.42
R6284:Trpc6	UTSW	9	8643600	missense	possibly damaging	0.93
R6773:Trpc6	UTSW	9	8634057	missense	probably damaging	1.00
R6874:Trpc6	UTSW	9	8680438	missense	probably damaging	1.00
R7032:Trpc6	UTSW	9	8609950	missense	probably damaging	1.00
R7142:Trpc6	UTSW	9	8653016	nonsense	probably null
R7489:Trpc6	UTSW	9	8656544	missense	probably benign	0.00
R7631:Trpc6	UTSW	9	8626701	missense	probably benign
R7762:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R7872:Trpc6	UTSW	9	8609909	missense	probably damaging	1.00
R7895:Trpc6	UTSW	9	8655218	missense	probably damaging	1.00
R7911:Trpc6	UTSW	9	8656704	missense	probably benign
R7955:Trpc6	UTSW	9	8609909	missense	probably damaging	1.00
R7978:Trpc6	UTSW	9	8655218	missense	probably damaging	1.00
R7992:Trpc6	UTSW	9	8656704	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTAGAACGGTTTTGCTTGCTACC -3'
(R):5'- TTCATTTTGGAGCTAGATCTTTGCC -3'

Sequencing Primer
(F):5'- GCTTGCTACCTGATAGATGGC -3'
(R):5'- TGCTGGACAGAATTCAACTACAG -3'

Posted On

2016-09-01