Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Tbc1d32'

427074

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.878) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56027993 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1226 (D1226G)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099739
AA Change: D1226G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: D1226G

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	not run
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGAGTCTTGATAACATTTGACAGT -3'
(R):5'- TCATGTATTACCGTTCAAGACTTTT -3'

Sequencing Primer
(F):5'- AATCCTCTGGAACTGTGAGC -3'
(R):5'- GACTTTTTAATAAGCAAGTGTGGC -3'

Posted On

2016-09-01