Incidental Mutation 'R5429:Herc4'
ID427075
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63275013 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 234 (N234K)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000218533] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: N234K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: N234K

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000218533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219177
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: N234K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
Factorial UTSW 10 63286068 missense probably benign 0.00
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1742:Herc4 UTSW 10 63287949 missense probably benign 0.16
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4014:Herc4 UTSW 10 63287544 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R4883:Herc4 UTSW 10 63285654 missense probably benign 0.00
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
R8515:Herc4 UTSW 10 63315786 missense probably benign 0.00
Z1176:Herc4 UTSW 10 63307749 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTTATCATAAGACCTGGAAACCC -3'
(R):5'- TGACAGCCGATCAAATGCAC -3'

Sequencing Primer
(F):5'- CTGGAAACCCAGTTTTATAGGCC -3'
(R):5'- GCCGATCAAATGCACAGTTC -3'
Posted On2016-09-01