Incidental Mutation 'R5429:Herc4'
ID427075
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63275013 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 234 (N234K)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000218533] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: N234K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: N234K

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000218533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219177
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: N234K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1742:Herc4 UTSW 10 63287949 missense probably benign 0.16
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4014:Herc4 UTSW 10 63287544 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R4883:Herc4 UTSW 10 63285654 missense probably benign 0.00
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTATCATAAGACCTGGAAACCC -3'
(R):5'- TGACAGCCGATCAAATGCAC -3'

Sequencing Primer
(F):5'- CTGGAAACCCAGTTTTATAGGCC -3'
(R):5'- GCCGATCAAATGCACAGTTC -3'
Posted On2016-09-01