Incidental Mutation 'R5429:Gad1-ps'
ID 427076
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 042995-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R5429 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99443838-99447029 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) G to A at 99445147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.2911 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99445448 exon noncoding transcript
IGL01301:Gad1-ps APN 10 99445151 exon noncoding transcript
IGL01394:Gad1-ps APN 10 99445562 exon noncoding transcript
IGL02220:Gad1-ps APN 10 99445322 exon noncoding transcript
IGL02240:Gad1-ps APN 10 99444958 exon noncoding transcript
IGL03406:Gad1-ps APN 10 99444779 exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99445151 exon noncoding transcript
R0305:Gad1-ps UTSW 10 99444803 exon noncoding transcript
R0446:Gad1-ps UTSW 10 99445521 exon noncoding transcript
R0538:Gad1-ps UTSW 10 99444992 exon noncoding transcript
R1511:Gad1-ps UTSW 10 99445469 exon noncoding transcript
R1734:Gad1-ps UTSW 10 99445775 exon noncoding transcript
R1745:Gad1-ps UTSW 10 99445524 exon noncoding transcript
R1886:Gad1-ps UTSW 10 99445582 exon noncoding transcript
R3111:Gad1-ps UTSW 10 99444521 exon noncoding transcript
R3617:Gad1-ps UTSW 10 99445398 exon noncoding transcript
R5042:Gad1-ps UTSW 10 99445654 exon noncoding transcript
R5223:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5234:Gad1-ps UTSW 10 99445326 exon noncoding transcript
R5275:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5295:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5334:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5335:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5336:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5337:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5396:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5397:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5399:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5428:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5431:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5661:Gad1-ps UTSW 10 99445039 exon noncoding transcript
R5667:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5671:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5885:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5886:Gad1-ps UTSW 10 99445147 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGCTTTGGAACAGACAATGTG -3'
(R):5'- AGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'
Posted On 2016-09-01