Mutagenetix > Incidental Mutation

Incidental Mutation 'R5429:Gad1-ps'

427076

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

042995-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 99445147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Meta Mutation Damage Score

0.2911

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0305:Gad1-ps	UTSW	10	99444803	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R3617:Gad1-ps	UTSW	10	99445398	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5223:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5295:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5335:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGCTTTGGAACAGACAATGTG -3'
(R):5'- AGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'

Posted On

2016-09-01