Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Trim7'

427077

Institutional Source

Beutler Lab

Gene Symbol

Trim7

Ensembl Gene

ENSMUSG00000040350

Gene Name

tripartite motif-containing 7

Synonyms

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48826140-48852209 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48849955 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 293 (C293Y)

Ref Sequence

ENSEMBL: ENSMUSP00000104836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046903
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350
AA Change: C500Y

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
RING	29	80	2.95e-7	SMART
BBOX	124	165	3.23e-13	SMART
low complexity region	232	244	N/A	INTRINSIC
coiled coil region	246	271	N/A	INTRINSIC
low complexity region	285	304	N/A	INTRINSIC
PRY	340	392	4.61e-18	SMART
SPRY	393	506	1.63e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109213
AA Change: C293Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350
AA Change: C293Y

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
coiled coil region	39	64	N/A	INTRINSIC
low complexity region	78	97	N/A	INTRINSIC
PRY	133	185	4.61e-18	SMART
SPRY	186	299	1.63e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129674

SMART Domains

Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131270

Predicted Effect

probably benign
Transcript: ENSMUST00000149049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156882

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Trim7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Trim7	APN	11	48845571	missense	probably damaging	0.99
IGL00476:Trim7	APN	11	48848078	missense	probably benign	0.39
R0119:Trim7	UTSW	11	48849712	missense	probably damaging	1.00
R0308:Trim7	UTSW	11	48849501	missense	probably damaging	0.96
R0546:Trim7	UTSW	11	48845509	missense	probably damaging	1.00
R1067:Trim7	UTSW	11	48837819	missense	probably damaging	0.99
R1081:Trim7	UTSW	11	48849705	missense	probably damaging	1.00
R2139:Trim7	UTSW	11	48838894	missense	probably benign	0.06
R3796:Trim7	UTSW	11	48845670	splice site	probably null
R3797:Trim7	UTSW	11	48845670	splice site	probably null
R3901:Trim7	UTSW	11	48837608	missense	probably damaging	0.98
R4157:Trim7	UTSW	11	48848093	missense	probably benign	0.00
R4603:Trim7	UTSW	11	48837528	start codon destroyed	probably null	0.98
R5915:Trim7	UTSW	11	48845650	missense	possibly damaging	0.95
R5988:Trim7	UTSW	11	48837686	missense	probably benign	0.01
R7960:Trim7	UTSW	11	48837801	missense	probably damaging	0.99
R8100:Trim7	UTSW	11	48849519	missense	probably damaging	1.00
Z1176:Trim7	UTSW	11	48849893	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGGCAATGCAACTCAAC -3'
(R):5'- CAGGGCCTCTTTGCTCAATC -3'

Sequencing Primer
(F):5'- CTCAACAATGGGCAATACTGGGC -3'
(R):5'- AATCAGTCTTCAGCGCCTGTG -3'

Posted On

2016-09-01