Incidental Mutation 'R5429:Trim7'
ID 427077
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Name tripartite motif-containing 7
Synonyms
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R5429 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 48826140-48852209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48849955 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 293 (C293Y)
Ref Sequence ENSEMBL: ENSMUSP00000104836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046903
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350
AA Change: C500Y

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109213
AA Change: C293Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350
AA Change: C293Y

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131270
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156882
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48845571 missense probably damaging 0.99
IGL00476:Trim7 APN 11 48848078 missense probably benign 0.39
R0119:Trim7 UTSW 11 48849712 missense probably damaging 1.00
R0308:Trim7 UTSW 11 48849501 missense probably damaging 0.96
R0546:Trim7 UTSW 11 48845509 missense probably damaging 1.00
R1067:Trim7 UTSW 11 48837819 missense probably damaging 0.99
R1081:Trim7 UTSW 11 48849705 missense probably damaging 1.00
R2139:Trim7 UTSW 11 48838894 missense probably benign 0.06
R3796:Trim7 UTSW 11 48845670 splice site probably null
R3797:Trim7 UTSW 11 48845670 splice site probably null
R3901:Trim7 UTSW 11 48837608 missense probably damaging 0.98
R4157:Trim7 UTSW 11 48848093 missense probably benign 0.00
R4603:Trim7 UTSW 11 48837528 start codon destroyed probably null 0.98
R5915:Trim7 UTSW 11 48845650 missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48837686 missense probably benign 0.01
R7960:Trim7 UTSW 11 48837801 missense probably damaging 0.99
R8100:Trim7 UTSW 11 48849519 missense probably damaging 1.00
R9121:Trim7 UTSW 11 48849847 missense probably damaging 1.00
R9289:Trim7 UTSW 11 48845454 nonsense probably null
R9574:Trim7 UTSW 11 48837633 missense not run
R9581:Trim7 UTSW 11 48848060 missense not run
Z1176:Trim7 UTSW 11 48849893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCAATGCAACTCAAC -3'
(R):5'- CAGGGCCTCTTTGCTCAATC -3'

Sequencing Primer
(F):5'- CTCAACAATGGGCAATACTGGGC -3'
(R):5'- AATCAGTCTTCAGCGCCTGTG -3'
Posted On 2016-09-01