Incidental Mutation 'R5429:Mboat1'
ID427084
Institutional Source Beutler Lab
Gene Symbol Mboat1
Ensembl Gene ENSMUSG00000038732
Gene Namemembrane bound O-acyltransferase domain containing 1
Synonyms9130215M02Rik, Oact1
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30136489-30246717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30219667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 150 (T150A)
Ref Sequence ENSEMBL: ENSMUSP00000045441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047311]
Predicted Effect probably benign
Transcript: ENSMUST00000047311
AA Change: T150A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045441
Gene: ENSMUSG00000038732
AA Change: T150A

DomainStartEndE-ValueType
Pfam:MBOAT 36 438 4.8e-29 PFAM
transmembrane domain 455 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152798
SMART Domains Protein: ENSMUSP00000121195
Gene: ENSMUSG00000038732

DomainStartEndE-ValueType
Pfam:MBOAT 9 209 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220870
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Mboat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Mboat1 APN 13 30195793 splice site probably benign
IGL01331:Mboat1 APN 13 30219701 splice site probably benign
IGL01837:Mboat1 APN 13 30241183 missense possibly damaging 0.72
IGL02070:Mboat1 APN 13 30224397 missense probably benign 0.02
IGL03338:Mboat1 APN 13 30136759 missense probably benign 0.01
langsat UTSW 13 30202375 missense probably benign 0.37
R0201:Mboat1 UTSW 13 30202375 missense probably benign 0.37
R0322:Mboat1 UTSW 13 30232080 splice site probably benign
R0448:Mboat1 UTSW 13 30202410 missense probably damaging 1.00
R1793:Mboat1 UTSW 13 30219650 missense probably damaging 0.99
R2040:Mboat1 UTSW 13 30241317 critical splice donor site probably null
R3054:Mboat1 UTSW 13 30195741 missense probably benign
R3122:Mboat1 UTSW 13 30238048 missense probably damaging 1.00
R4948:Mboat1 UTSW 13 30241230 missense probably damaging 1.00
R4958:Mboat1 UTSW 13 30224393 missense probably damaging 1.00
R4992:Mboat1 UTSW 13 30202360 missense possibly damaging 0.80
R5862:Mboat1 UTSW 13 30235697 missense probably damaging 1.00
R6025:Mboat1 UTSW 13 30224526 missense probably benign
R6352:Mboat1 UTSW 13 30202420 missense possibly damaging 0.59
R6956:Mboat1 UTSW 13 30238076 missense possibly damaging 0.89
R7088:Mboat1 UTSW 13 30195789 critical splice donor site probably null
R7165:Mboat1 UTSW 13 30224415 missense probably damaging 1.00
R7366:Mboat1 UTSW 13 30202362 missense possibly damaging 0.94
R7727:Mboat1 UTSW 13 30226306 missense probably benign 0.00
Z1177:Mboat1 UTSW 13 30226378 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTACTGTTATGCCTGCATATGC -3'
(R):5'- GCGGTGGATTCCATAAGGAC -3'

Sequencing Primer
(F):5'- GCATATGCAAAGCAACTTGCAAG -3'
(R):5'- ATTCCATAAGGACATGGGGAGTGTTG -3'
Posted On2016-09-01