Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Itih3'

427087

Institutional Source

Beutler Lab

Gene Symbol

Itih3

Ensembl Gene

ENSMUSG00000006522

Gene Name

inter-alpha trypsin inhibitor, heavy chain 3

Synonyms

Itih-3, Intin3

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30908572-30923760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30923521 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 10 (V10A)

Ref Sequence

ENSEMBL: ENSMUSP00000154659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000227995]

Predicted Effect

probably benign
Transcript: ENSMUST00000006697
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VIT	29	158	3.87e-83	SMART
VWA	282	466	1.19e-29	SMART
Blast:VWA	571	634	2e-21	BLAST
Pfam:ITI_HC_C	683	870	3e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112141

Predicted Effect

probably benign
Transcript: ENSMUST00000170415
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: V10A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VIT	29	158	3.87e-83	SMART
VWA	282	466	1.19e-29	SMART
Pfam:ITI_HC_C	503	680	1.5e-67	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227181

Predicted Effect

probably benign
Transcript: ENSMUST00000227995
AA Change: V10A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Itih3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Itih3	APN	14	30909781	missense	probably damaging	0.98
IGL01359:Itih3	APN	14	30917772	missense	probably damaging	1.00
IGL01965:Itih3	APN	14	30915720	missense	probably damaging	0.99
IGL02435:Itih3	APN	14	30915754	missense	probably damaging	0.99
IGL02539:Itih3	APN	14	30912664	missense	probably benign	0.03
IGL02637:Itih3	APN	14	30915660	missense	probably benign	0.00
IGL02958:Itih3	APN	14	30913182	missense	probably benign	0.00
IGL03253:Itih3	APN	14	30911923	critical splice donor site	probably null
K2124:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R0321:Itih3	UTSW	14	30912106	missense	probably damaging	0.99
R0466:Itih3	UTSW	14	30912874	critical splice donor site	probably null
R1402:Itih3	UTSW	14	30908708	missense	probably damaging	1.00
R1402:Itih3	UTSW	14	30908708	missense	probably damaging	1.00
R1633:Itih3	UTSW	14	30917398	missense	possibly damaging	0.46
R1982:Itih3	UTSW	14	30923583	unclassified	probably benign
R2056:Itih3	UTSW	14	30909524	splice site	probably null
R2077:Itih3	UTSW	14	30909835	missense	possibly damaging	0.91
R2417:Itih3	UTSW	14	30917664	missense	probably benign	0.04
R3624:Itih3	UTSW	14	30914743	missense	probably damaging	1.00
R3794:Itih3	UTSW	14	30918394	missense	probably damaging	1.00
R4676:Itih3	UTSW	14	30918949	missense	probably null	1.00
R4676:Itih3	UTSW	14	30921686	missense	possibly damaging	0.91
R5198:Itih3	UTSW	14	30912649	missense	probably benign	0.07
R6379:Itih3	UTSW	14	30909724	missense	probably damaging	1.00
R6740:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R6752:Itih3	UTSW	14	30923489	missense	possibly damaging	0.76
R6765:Itih3	UTSW	14	30909473	missense	probably benign
R6785:Itih3	UTSW	14	30912615	critical splice donor site	probably null
R6871:Itih3	UTSW	14	30912687	missense	probably benign	0.40
R6935:Itih3	UTSW	14	30912702	missense	possibly damaging	0.82
R7133:Itih3	UTSW	14	30917698	missense	probably damaging	1.00
R7419:Itih3	UTSW	14	30914773	missense	probably benign	0.41
R7592:Itih3	UTSW	14	30908765	missense	probably damaging	0.98
R7598:Itih3	UTSW	14	30917377	missense	possibly damaging	0.95
R7662:Itih3	UTSW	14	30917330	missense	probably benign	0.00
Y5408:Itih3	UTSW	14	30921945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAACACACTGTCCAGTCCTAAG -3'
(R):5'- CCGCCCCAACACTGTTATTG -3'

Sequencing Primer
(F):5'- ACACTGTCCAGTCCTAAGCTTCC -3'
(R):5'- CAACACTGTTATTGTATCCACGGGG -3'

Posted On

2016-09-01