Incidental Mutation 'R5429:Itih3'
ID427087
Institutional Source Beutler Lab
Gene Symbol Itih3
Ensembl Gene ENSMUSG00000006522
Gene Nameinter-alpha trypsin inhibitor, heavy chain 3
SynonymsItih-3, Intin3
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30908572-30923760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30923521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000154659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000227995]
Predicted Effect probably benign
Transcript: ENSMUST00000006697
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Blast:VWA 571 634 2e-21 BLAST
Pfam:ITI_HC_C 683 870 3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112141
Predicted Effect probably benign
Transcript: ENSMUST00000170415
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Pfam:ITI_HC_C 503 680 1.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227181
Predicted Effect probably benign
Transcript: ENSMUST00000227995
AA Change: V10A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Itih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Itih3 APN 14 30909781 missense probably damaging 0.98
IGL01359:Itih3 APN 14 30917772 missense probably damaging 1.00
IGL01965:Itih3 APN 14 30915720 missense probably damaging 0.99
IGL02435:Itih3 APN 14 30915754 missense probably damaging 0.99
IGL02539:Itih3 APN 14 30912664 missense probably benign 0.03
IGL02637:Itih3 APN 14 30915660 missense probably benign 0.00
IGL02958:Itih3 APN 14 30913182 missense probably benign 0.00
IGL03253:Itih3 APN 14 30911923 critical splice donor site probably null
K2124:Itih3 UTSW 14 30912687 missense probably benign 0.40
R0321:Itih3 UTSW 14 30912106 missense probably damaging 0.99
R0466:Itih3 UTSW 14 30912874 critical splice donor site probably null
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1633:Itih3 UTSW 14 30917398 missense possibly damaging 0.46
R1982:Itih3 UTSW 14 30923583 unclassified probably benign
R2056:Itih3 UTSW 14 30909524 splice site probably null
R2077:Itih3 UTSW 14 30909835 missense possibly damaging 0.91
R2417:Itih3 UTSW 14 30917664 missense probably benign 0.04
R3624:Itih3 UTSW 14 30914743 missense probably damaging 1.00
R3794:Itih3 UTSW 14 30918394 missense probably damaging 1.00
R4676:Itih3 UTSW 14 30918949 missense probably null 1.00
R4676:Itih3 UTSW 14 30921686 missense possibly damaging 0.91
R5198:Itih3 UTSW 14 30912649 missense probably benign 0.07
R6379:Itih3 UTSW 14 30909724 missense probably damaging 1.00
R6740:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6752:Itih3 UTSW 14 30923489 missense possibly damaging 0.76
R6765:Itih3 UTSW 14 30909473 missense probably benign
R6785:Itih3 UTSW 14 30912615 critical splice donor site probably null
R6871:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6935:Itih3 UTSW 14 30912702 missense possibly damaging 0.82
R7133:Itih3 UTSW 14 30917698 missense probably damaging 1.00
R7419:Itih3 UTSW 14 30914773 missense probably benign 0.41
R7592:Itih3 UTSW 14 30908765 missense probably damaging 0.98
R7598:Itih3 UTSW 14 30917377 missense possibly damaging 0.95
R7662:Itih3 UTSW 14 30917330 missense probably benign 0.00
Y5408:Itih3 UTSW 14 30921945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAACACACTGTCCAGTCCTAAG -3'
(R):5'- CCGCCCCAACACTGTTATTG -3'

Sequencing Primer
(F):5'- ACACTGTCCAGTCCTAAGCTTCC -3'
(R):5'- CAACACTGTTATTGTATCCACGGGG -3'
Posted On2016-09-01