Incidental Mutation 'R5429:Ppp2r2a'
ID427088
Institutional Source Beutler Lab
Gene Symbol Ppp2r2a
Ensembl Gene ENSMUSG00000022052
Gene Nameprotein phosphatase 2, regulatory subunit B, alpha
Synonyms2410004D02Rik
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67014056-67072444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67023756 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 172 (F172I)
Ref Sequence ENSEMBL: ENSMUSP00000153191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]
Predicted Effect probably damaging
Transcript: ENSMUST00000089230
AA Change: F172I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: F172I

DomainStartEndE-ValueType
WD40 21 56 1.33e1 SMART
WD40 83 123 6.88e0 SMART
WD40 165 204 2.3e0 SMART
WD40 215 255 8.88e0 SMART
WD40 274 312 5.11e1 SMART
WD40 339 370 1.42e2 SMART
WD40 406 443 2.47e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223630
Predicted Effect probably benign
Transcript: ENSMUST00000225251
Predicted Effect probably damaging
Transcript: ENSMUST00000225380
AA Change: F172I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Ppp2r2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Ppp2r2a APN 14 67070277 missense probably damaging 0.96
IGL01997:Ppp2r2a APN 14 67016519 missense probably benign
IGL02024:Ppp2r2a APN 14 67038912 missense probably benign 0.06
IGL02178:Ppp2r2a APN 14 67023097 missense probably damaging 1.00
IGL03148:Ppp2r2a APN 14 67022295 missense probably benign 0.00
IGL03304:Ppp2r2a APN 14 67016528 missense probably benign 0.13
limber UTSW 14 67019804 missense probably damaging 1.00
R1216:Ppp2r2a UTSW 14 67028998 nonsense probably null
R1576:Ppp2r2a UTSW 14 67038869 splice site probably benign
R1629:Ppp2r2a UTSW 14 67019759 missense possibly damaging 0.93
R1662:Ppp2r2a UTSW 14 67016603 missense probably benign
R1808:Ppp2r2a UTSW 14 67038963 missense probably damaging 1.00
R1937:Ppp2r2a UTSW 14 67016429 missense possibly damaging 0.93
R2121:Ppp2r2a UTSW 14 67023128 missense probably damaging 1.00
R2134:Ppp2r2a UTSW 14 67016475 missense possibly damaging 0.63
R3150:Ppp2r2a UTSW 14 67023765 missense probably damaging 1.00
R3694:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3695:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3825:Ppp2r2a UTSW 14 67022443 missense probably damaging 0.98
R4031:Ppp2r2a UTSW 14 67028976 missense probably damaging 1.00
R4209:Ppp2r2a UTSW 14 67028879 missense probably damaging 1.00
R4353:Ppp2r2a UTSW 14 67028937 missense probably damaging 1.00
R4639:Ppp2r2a UTSW 14 67038957 missense probably damaging 1.00
R4976:Ppp2r2a UTSW 14 67016637 missense possibly damaging 0.71
R5001:Ppp2r2a UTSW 14 67022308 nonsense probably null
R5106:Ppp2r2a UTSW 14 67023097 missense probably damaging 1.00
R5322:Ppp2r2a UTSW 14 67038873 critical splice donor site probably null
R5360:Ppp2r2a UTSW 14 67016571 nonsense probably null
R5439:Ppp2r2a UTSW 14 67022323 missense possibly damaging 0.70
R6250:Ppp2r2a UTSW 14 67038954 missense probably damaging 1.00
R6582:Ppp2r2a UTSW 14 67019804 missense probably damaging 1.00
R8263:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R8315:Ppp2r2a UTSW 14 67023728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGACTCAAATATATCTAGGAGAG -3'
(R):5'- TGCTTAACAGAACCAACATCAGTG -3'

Sequencing Primer
(F):5'- TAGGAGAGAAGATAAATCTAATGGGG -3'
(R):5'- TCATGGTCTTGTGACTCTT -3'
Posted On2016-09-01