Mutagenetix > Incidental Mutation

Incidental Mutation 'R5429:Sntb1'

427091

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

042995-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55642795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 461 (G461R)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

AlphaFold

Q99L88

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTAAGTAGTCAGGCCGCCTAC -3'
(R):5'- AAGAAATTCGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTCATTGCACATG -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'

Posted On

2016-09-01