Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Scaf8'

427096

Institutional Source

Beutler Lab

Gene Symbol

Scaf8

Ensembl Gene

ENSMUSG00000046201

Gene Name

SR-related CTD-associated factor 8

Synonyms

Rbm16, A630086M08Rik, A930036P18Rik

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.749) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3114972-3198859 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 3197110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 903 (P903T)

Ref Sequence

ENSEMBL: ENSMUSP00000076024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076734]

AlphaFold

Q6DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000076734
AA Change: P903T

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: P903T

Domain	Start	End	E-Value	Type
RPR	6	136	1.26e-42	SMART
low complexity region	157	171	N/A	INTRINSIC
low complexity region	193	223	N/A	INTRINSIC
low complexity region	232	251	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	397	462	N/A	INTRINSIC
RRM	478	547	9.2e-14	SMART
low complexity region	644	677	N/A	INTRINSIC
low complexity region	685	712	N/A	INTRINSIC
low complexity region	857	883	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
low complexity region	962	971	N/A	INTRINSIC
low complexity region	1027	1044	N/A	INTRINSIC
internal_repeat_1	1048	1064	2e-5	PROSPERO
internal_repeat_1	1059	1075	2e-5	PROSPERO
low complexity region	1146	1168	N/A	INTRINSIC
low complexity region	1249	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231685

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Scaf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Scaf8	APN	17	3171134	missense	unknown
IGL00956:Scaf8	APN	17	3171147	missense	unknown
IGL01610:Scaf8	APN	17	3195849	missense	probably damaging	1.00
IGL01967:Scaf8	APN	17	3196938	missense	possibly damaging	0.91
IGL02005:Scaf8	APN	17	3185870	missense	probably damaging	1.00
IGL03037:Scaf8	APN	17	3190221	missense	probably damaging	0.99
BB004:Scaf8	UTSW	17	3159220	missense	unknown
BB014:Scaf8	UTSW	17	3159220	missense	unknown
R0320:Scaf8	UTSW	17	3178255	missense	unknown
R0789:Scaf8	UTSW	17	3196837	missense	possibly damaging	0.94
R0850:Scaf8	UTSW	17	3195774	splice site	probably null
R0919:Scaf8	UTSW	17	3197120	missense	probably damaging	1.00
R1488:Scaf8	UTSW	17	3197597	missense	probably damaging	0.97
R1544:Scaf8	UTSW	17	3145154	missense	probably damaging	0.96
R1928:Scaf8	UTSW	17	3168077	missense	unknown
R1972:Scaf8	UTSW	17	3169371	missense	unknown
R2156:Scaf8	UTSW	17	3164132	splice site	probably null
R2164:Scaf8	UTSW	17	3197210	missense	probably damaging	1.00
R2680:Scaf8	UTSW	17	3197591	missense	possibly damaging	0.95
R3794:Scaf8	UTSW	17	3190249	missense	probably damaging	1.00
R4368:Scaf8	UTSW	17	3171195	missense	unknown
R4673:Scaf8	UTSW	17	3197985	missense	probably benign	0.04
R4694:Scaf8	UTSW	17	3197404	missense	probably damaging	1.00
R4716:Scaf8	UTSW	17	3177123	missense	unknown
R4852:Scaf8	UTSW	17	3178219	missense	unknown
R5036:Scaf8	UTSW	17	3164262	unclassified	probably benign
R5193:Scaf8	UTSW	17	3190165	missense	probably benign	0.02
R5816:Scaf8	UTSW	17	3177713	missense	unknown
R6050:Scaf8	UTSW	17	3168108	missense	unknown
R6493:Scaf8	UTSW	17	3171119	missense	unknown
R6616:Scaf8	UTSW	17	3168055	missense	unknown
R7065:Scaf8	UTSW	17	3159211	missense	probably damaging	1.00
R7112:Scaf8	UTSW	17	3163029	missense	unknown
R7141:Scaf8	UTSW	17	3159182	missense	unknown
R7198:Scaf8	UTSW	17	3163098	missense	unknown
R7265:Scaf8	UTSW	17	3177625	missense	unknown
R7592:Scaf8	UTSW	17	3171222	critical splice donor site	probably null
R7711:Scaf8	UTSW	17	3187634	missense	probably damaging	0.97
R7813:Scaf8	UTSW	17	3197274	missense	probably damaging	1.00
R7867:Scaf8	UTSW	17	3177719	missense	unknown
R7927:Scaf8	UTSW	17	3159220	missense	unknown
R7937:Scaf8	UTSW	17	3197207	missense	probably damaging	0.99
R7958:Scaf8	UTSW	17	3171122	missense	unknown
R7960:Scaf8	UTSW	17	3171122	missense	unknown
R8024:Scaf8	UTSW	17	3159293	missense	unknown
R8118:Scaf8	UTSW	17	3164183	missense	unknown
R8285:Scaf8	UTSW	17	3177129	missense	unknown
R8303:Scaf8	UTSW	17	3148552	missense	unknown
R8365:Scaf8	UTSW	17	3195966	missense	possibly damaging	0.67
R8544:Scaf8	UTSW	17	3163020	unclassified	probably benign
R8768:Scaf8	UTSW	17	3193074	missense	probably benign	0.27
Z1088:Scaf8	UTSW	17	3162983	unclassified	probably benign
Z1177:Scaf8	UTSW	17	3162994	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGGTTCGTCCAGCTAATGTTTCC -3'
(R):5'- GCTGCATCAAGTACCGATGG -3'

Sequencing Primer
(F):5'- TCCAACAGTGCTGCAATTATGGG -3'
(R):5'- CATCAAGTACCGATGGGGGAG -3'

Posted On

2016-09-01