Incidental Mutation 'R5429:Pdpk1'
ID427097
Institutional Source Beutler Lab
Gene Symbol Pdpk1
Ensembl Gene ENSMUSG00000024122
Gene Name3-phosphoinositide dependent protein kinase 1
SynonymsPkb kinase, Pdk1
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24073680-24150924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24091560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000111068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052462] [ENSMUST00000102927] [ENSMUST00000115407] [ENSMUST00000115409] [ENSMUST00000115411]
Predicted Effect probably benign
Transcript: ENSMUST00000052462
AA Change: E305G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122
AA Change: E305G

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102927
AA Change: E332G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122
AA Change: E332G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115407
AA Change: E332G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122
AA Change: E332G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115409
AA Change: E205G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122
AA Change: E205G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115411
AA Change: E332G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122
AA Change: E332G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147199
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit embryogenesis defects, impaired forebrain development, and die by mid gestation. Cardiac muscle-specific conditional mutants exhibit thin ventricular walls and die of heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Pdpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdpk1 APN 17 24106861 missense possibly damaging 0.87
IGL01467:Pdpk1 APN 17 24088170 missense probably damaging 0.98
IGL02251:Pdpk1 APN 17 24079638 missense probably damaging 1.00
IGL03411:Pdpk1 APN 17 24101644 missense probably damaging 1.00
R0152:Pdpk1 UTSW 17 24106946 missense possibly damaging 0.93
R0610:Pdpk1 UTSW 17 24098171 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1817:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1819:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1822:Pdpk1 UTSW 17 24098176 splice site probably benign
R1823:Pdpk1 UTSW 17 24098176 splice site probably benign
R3783:Pdpk1 UTSW 17 24110850 missense possibly damaging 0.95
R4653:Pdpk1 UTSW 17 24106897 missense probably benign 0.25
R5000:Pdpk1 UTSW 17 24111045 missense possibly damaging 0.66
R5385:Pdpk1 UTSW 17 24098140 nonsense probably null
R5425:Pdpk1 UTSW 17 24098121 missense probably damaging 1.00
R5642:Pdpk1 UTSW 17 24106855 nonsense probably null
R5936:Pdpk1 UTSW 17 24093229 missense probably damaging 1.00
R6049:Pdpk1 UTSW 17 24098135 nonsense probably null
R6332:Pdpk1 UTSW 17 24106922 missense probably damaging 0.99
R6693:Pdpk1 UTSW 17 24111126 splice site probably null
R7423:Pdpk1 UTSW 17 24110900 missense probably benign 0.08
R7432:Pdpk1 UTSW 17 24101669 missense probably benign 0.43
RF016:Pdpk1 UTSW 17 24093281 missense probably benign 0.01
Z1177:Pdpk1 UTSW 17 24088013 missense not run
Predicted Primers PCR Primer
(F):5'- AGCAGAATTTCTTTTGCCTGGG -3'
(R):5'- TGGTCTGAGGCAAGAGTCCTAG -3'

Sequencing Primer
(F):5'- AGAATTTCTTTTGCCTGGGCTACAC -3'
(R):5'- GTCTGAGGCAAGAGTCCTAGTTAATC -3'
Posted On2016-09-01