Incidental Mutation 'R5429:Safb'
ID427099
Institutional Source Beutler Lab
Gene Symbol Safb
Ensembl Gene ENSMUSG00000071054
Gene Namescaffold attachment factor B
Synonyms3110021E02Rik, SAFB1, 5330423C17Rik
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56584825-56606294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56588822 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000138743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075510] [ENSMUST00000095224] [ENSMUST00000133604] [ENSMUST00000144255] [ENSMUST00000155983] [ENSMUST00000182533] [ENSMUST00000182800]
Predicted Effect probably benign
Transcript: ENSMUST00000075510
SMART Domains Protein: ENSMUSP00000074953
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
coiled coil region 262 285 N/A INTRINSIC
low complexity region 286 294 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
RRM 452 525 1.33e-19 SMART
low complexity region 557 578 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
coiled coil region 658 772 N/A INTRINSIC
low complexity region 798 815 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095224
AA Change: V77A
SMART Domains Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133604
SMART Domains Protein: ENSMUSP00000119324
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144255
SMART Domains Protein: ENSMUSP00000123673
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146958
Predicted Effect probably benign
Transcript: ENSMUST00000155983
SMART Domains Protein: ENSMUSP00000116363
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182031
Predicted Effect unknown
Transcript: ENSMUST00000182533
AA Change: V77A
SMART Domains Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182800
AA Change: V20A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000182951
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Safb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Safb APN 17 56602974 unclassified probably benign
IGL02391:Safb APN 17 56600813 splice site probably benign
IGL03145:Safb APN 17 56605287 missense probably damaging 1.00
R0245:Safb UTSW 17 56606025 missense probably damaging 1.00
R0464:Safb UTSW 17 56606025 missense probably damaging 1.00
R0468:Safb UTSW 17 56606025 missense probably damaging 1.00
R0479:Safb UTSW 17 56606025 missense probably damaging 1.00
R0496:Safb UTSW 17 56605630 missense probably benign 0.05
R0639:Safb UTSW 17 56601092 utr 3 prime probably benign
R0655:Safb UTSW 17 56597803 missense probably benign 0.23
R1109:Safb UTSW 17 56601228 splice site probably benign
R1941:Safb UTSW 17 56598992 intron probably benign
R1969:Safb UTSW 17 56605821 missense probably benign 0.32
R1971:Safb UTSW 17 56605821 missense probably benign 0.32
R4010:Safb UTSW 17 56603765 unclassified probably benign
R4132:Safb UTSW 17 56600848 utr 3 prime probably benign
R5681:Safb UTSW 17 56599000 intron probably benign
R5900:Safb UTSW 17 56600349 missense unknown
R6077:Safb UTSW 17 56602956 unclassified probably benign
R6173:Safb UTSW 17 56597798 missense probably damaging 1.00
R6367:Safb UTSW 17 56593845 unclassified probably benign
R6735:Safb UTSW 17 56585169 unclassified probably benign
R6736:Safb UTSW 17 56606023 missense possibly damaging 0.46
R7834:Safb UTSW 17 56593881 missense unknown
R7909:Safb UTSW 17 56595665 missense unknown
R7917:Safb UTSW 17 56593881 missense unknown
R7990:Safb UTSW 17 56595665 missense unknown
X0065:Safb UTSW 17 56603798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAGTTTCAATGCCCTG -3'
(R):5'- GCTCTGTTAGTACATGGGCC -3'

Sequencing Primer
(F):5'- GCTGAGTTTCAATGCCCTGAGAAC -3'
(R):5'- GGGCCTTATTTTCTGACAGACAAG -3'
Posted On2016-09-01